An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037975.1

General info


NONCODE TRANSCRIPT IDNONMMUT037975.1
NONCODE Gene IDNONMMUG092130.1
Chromosomechr2
Start Site74685334
End Site74685907
Strand+
Exon Number1
CNCI Score-0.0004096
Length573
Assemblymm10
Other transcript VersionsNONMMUT037975.1(old version)

Sequence


>NONMMUT037975.1
AACCTTGAACTGTCTAGACAACACCATAAAACCCAAAGTTCTAAACAGCTTAATTGGGTTATATTATACACCTTCTGGTGGGCCCAAAAGAGATTTCCGCAATGTGCAATAAACTGGAGACGTGAGAAAACCTCCTCTTGATCTGACCAGAGTGAAGTGGATCTCATGACTCTTAACCTCTCAGAAGCCCAAAGTCTAAAAATAAATCCATAAGATGCACAGCAGCTCATGCCTCTTCTGAGGAAGTATGCTTTTTAAAATATGAATTTTTTAAATTGCCAAAGCTTTGGGGGGGGTAAAGAAAAACATAAGTGTATAAGTGTATGCCTTTGAACTTCCAAAATGTCAAGGTCATCACCTTTAACCTCTCTGAATAATTAGGCGCCTTAAAGTTCTTCTGTGATTTCTAACCACCGCCCAGGCTCATACATCCAGACCCACACACATATTTATGACCATACAGATTCATACTGGGGGTTCACCATAAATCTAGGAAAATTCCTAATTTCAGGATCAATAACTATAATTTCCCTCCCAACATTTGAGTAATTTAATAGCAACTGACTTCTTAGG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT037975
noncodeV3n297385