An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037976.1

General info


NONCODE TRANSCRIPT IDNONMMUT037976.1
NONCODE Gene IDNONMMUG023450.2
Chromosomechr2
Start Site74695519
End Site74697365
Strand+
Exon Number2
CNCI Score-0.0229376
Length548
Assemblymm10
Other transcript VersionsNONMMUT037976.1(old version)

Sequence


>NONMMUT037976.1
TTCAGTGAGCTCTTGGTGACTTCTGGCTGGGGAAGCCATCTTCAGGGGCTAGGTTGAAACTAGTAATGCCCACCTGGAACCTGGCTGGCCTCCATTGCAGGAACAAGCAACAGCTTAGCAGGGCACTGGATCCAATTGTGCCCCCCCAAGTCCCTTTCTCTTTCCCACCCGCCCCAAGCTCAAGACAACCAGACCCAGTGAAGCCAAGGTTGGGGCCATTCCAGAAGGCTGGGGAAAGATGAGGCACCATGGCCATCACTGTCGGCTCCTTGGGACTCCAGTGCTCACCACCCATGCGAGGGCAGAGAGACAGCCCTTGGAGGCCGCCCCTTGGAAGCCATGCTGAGCTGGACCAGGCCCGAGAGTCCAGTTGACCCAGCTCACCCCCTGGGCCTCGGGGCGTGTGCCTAGCTTTTTGTCGAGGGTTTACATGTGGCTGCCCCGGGAGTGTGAGCGCGGTAGAGGGAGGGGCACTCCGAGCTGCTCCATCCGTCCGTTTTATTAGGGACACATTAATCTATAATCAAATACACCTCATAAAATTTTTA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT107327.1

Data Sources

Source NameOld Id
PMID235831TCONS_00017279
gencodeENSMUST00000126966.4
NONCODEv4NONMMUT037976
NONCODEv3n419685
PMID26117828PNCT_MMU153533
ensemblENSMUST00000126966