An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037977.1

General info


NONCODE TRANSCRIPT IDNONMMUT037977.1
NONCODE Gene IDNONMMUG023451.2
Chromosomechr2
Start Site74703247
End Site74712054
Strand-
Exon Number2
CNCI Score-0.1961984
Length460
Assemblymm10
Other transcript VersionsNONMMUT037977.1(old version)

Sequence


>NONMMUT037977.1
GGTGGAGTCGCGGCGGGAGCCCAGGCCGCTGCGGACCACGCGATCCCGCAGCCGGCGACTAGAGCCCACCTCTGCAGAGACAAAGGTGCTGAACCCTTTATCCTTTGGGATAATCCGGTGCCGGGAGGACACCAGGCTCTCTGATCTTGAGGACAGACCTAGAAGATGCACCCCAGCTCACCAAAGACTCTCCAGCTTACACTAAATCACACCGTGCTGACCTCCCACGGCCAAATACAAATGCCTAAAAACCCAGATGGACTCAAAGATTCAGGAGGCCAGAATTTTAACGACCTTCCATCCCTTGCGGGGGTTGTTCAGCCCCTGTGGAAAGAATCGCGAGGTCAGTCCGAGAGGTCTGAATCTCCTTTTTATAAATAAGGTCATCATAGAAAGGCATTTTCGTTAGTAATGTATAACTCAATTATTTCGACAAGGAATAGCTAAAAGTGGTGAAGGT

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT037978.2
NONMMUT037979.2
NONMMUT037980.2
NONMMUT037982.2

Data Sources

Source NameOld Id
PMID235831TCONS_00017749
PMID26117828TCONS_00006733
ensemblENSMUST00000132326
PMID26117828PNCT_MMU153534
NONCODEv3n412253
NONCODEv4NONMMUT037977
gencodeENSMUST00000132326.1