An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037977.1

General info


NONCODE TRANSCRIPT IDNONMMUT037977.1
NONCODE Gene IDNONMMUG023451.1
Chromosomechr2
Start Site74541304
End Site74550111
Strand-
Exon Number2
CNCI Score-0.4798982
Length460
Assemblymm9
Other transcript VersionsNONMMUT037977.2

Sequence


>NONMMUT037977.1
GGTGGAGTCGCGGCGGGAGCCCAGGCCGCTGCGGACCACGCGATCCCGCAGCCGGCGACTAGAGCCCACCTCTGCAGAGACAAAGGTGCTGAACCCTTTATCCTTTGGGATAATCCGGTGCCGGGAGGACACCAGGCTCTCTGATCTTGAGGACAGACCTAGAAGATGCACCCCAGCTCACCAAAGACTCTCCAGCTTACACTAAATCACACCGTGCTGACCTCCCACGGCCAAATACAAATGCCTAAAAACCCAGATGGACTCAAAGATTCAGGAGGCCAGAATTTTAACGACCTTCCATCCCTTGCGGGGGTTGTTCAGCCCCTGTGGAAAGAATCGCGAGGTCAGTCCGAGAGGTCTGAATCTCCTTTTTATAAATAAGGTCATCATAGAAAGGCATTTTCGTTAGTAATGTATAACTCAATTATTTCGACAAGGAATAGCTAAAAGTGGTGAAGGT

Expression Profile(Data Source:)

NA

Isoforms

Transcript ID
NONMMUT037978.1
NONMMUT037979.1
NONMMUT037980.1
NONMMUT037982.1

Data Sources

Source NameOld Id
PMID235831TCONS_00017749
PMID26117828TCONS_00006733
ensemblENSMUST00000132326
PMID26117828PNCT_MMU153534
NONCODEv3n412253
NONCODEv4NONMMUT037977
gencodeENSMUST00000132326.1