An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037979.2

General info


NONCODE TRANSCRIPT IDNONMMUT037979.2
NONCODE Gene IDNONMMUG023451.2
Chromosomechr2
Start Site74710042
End Site74712526
Strand-
Exon Number2
CNCI Score-0.0692224
Length796
Assemblymm10
Other transcript VersionsNONMMUT037979.1(old version)

Sequence


>NONMMUT037979.2
GGGTGGGGTGAGGTGAGAGACACGAAGGAGTCCCCAATGCACTTTTGAGCCTAGCAGGACCCTACCTCGAGCCCCAAGGGACATACTTTAGGGACGAGGATGCAGAGAGCGATCCCCAGGTTCTTGAATAACGCGGGGAGCTGGGGAAGTGGCACCCATTGCCCGAGGCGGTGGAGCGGGCAGCTCCTGCGCCAGCAGGGTGGCTCTTACCCGGAGGGTGCCGAACTGCGGGCGGTCGGCCCGGACTGTGGCTGGAATCCATCCGGCGCTGCCCGGCTGCGCTCACCATCCTCGGCAGGTTTGGGCTCATGTTGCTGGAGGGATCGGGTAGGAAGCTCGGGACCAGGGTTGAAGCAGGCGGTCGGCTCCCTGCTGGAGTGTGAGAGGCGGCTGGTGGCTCGGCGCCCGGGGCTCCTTCCGGGCTCCCCGCCGGCTCTGGAAGCGGCCGCAATCGCGACCGGGGGCGAGCTGCGGTGGAGTCGCGGCGGGAGCCCAGGCCGCTGCGGACCACGCGATCCCGCAGCCGGCGACTAGAGCCCACCTCTGCAGAGACAAAGACACCCAAGGATTCAGCAAACATCCAAGATATGGAGGAGACACTAGATGTGAATTCTTATGCAGTGAATTAAACAATATGTTATTACACAAGGAAATGGGCAAGCTGGTGCTTATTCCCTGGTCGATACACATAGAAGTGGGTAAAGAGATTGTTCAATTCTAAAACATTCTAAAAATTAATCTCAATTTGCCTCTGTATCATCTGCCCTCTATCCAAATAAAAGCAGAGCTTATCCCA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT037977.2
NONMMUT037978.2
NONMMUT037980.2
NONMMUT037982.2

Data Sources

Source NameOld Id
NONCODEv3n413202
NONCODEv4NONMMUT037979
gencodeENSMUST00000156342.1
PMID26117828TCONS_00006734
PMID26117828PNCT_MMU153535
ensemblENSMUST00000156342
PMID235831TCONS_00017750