An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037980.1

General info


NONCODE TRANSCRIPT IDNONMMUT037980.1
NONCODE Gene IDNONMMUG023451.2
Chromosomechr2
Start Site74710043
End Site74716130
Strand-
Exon Number3
CNCI Score-0.0704512
Length794
Assemblymm10
Other transcript VersionsNONMMUT037980.1(old version)

Sequence


>NONMMUT037980.1
AGAGATGCCTGGTTGAGGGCAGCTGGCGGACAAGTGATCACACCACCCACCCTTGTCTGATGCCACGCACGCTGAGCGCTGAGCGAGCTGAGGTGGAAGGCGGGGCAGAAGAACGGGTGGCTCTTGTGTCCTCCCATTCCCCTCCCACCCAGGGCATGGGCGGCATCGGCGAAGCCAGCGAGACGCTTGTCCTACAGCGCCTCCTCCTGGACAAAGCTCCAGACAACCGAAAAGGGACACCACCAGCCCTAGAAAACCTAGACTAGGCACTTCCTTCCTGGGACATCAGAAGTTGATTCTGCCACGTCCACTGGAGAGGCAAAAAGGAGTCCAAAAGTCCTTGAGGCTACCTCTTACCGCCCCACCCCCAGCTCAGACAACAAGCCTGTGACCCAGAAGCGAGCATCTCATCTCTCCTTGATTAGACTTTCCAGAGACTGCACTCCCAGCTCTTGTGTCCACCCAAGAAGAAACCAAGGCCAGGACATTGGCTCCCCAGTCTATAAATAGAAGTTTGGACCCAGGACGCTGGGAGTTTTGCCCAGAAACCTCTAAGACACCCAAGGATTCAGCAAACATCCAAGATATGGAGGAGACACTAGATGTGAATTCTTATGCAGTGAATTAAACAATATGTTATTACACAAGGAAATGGGCAAGCTGGTGCTTATTCCCTGGTCGATACACATAGAAGTGGGTAAAGAGATTGTTCAATTCTAAAACATTCTAAAAATTAATCTCAATTTGCCTCTGTATCATCTGCCCTCTATCCAAATAAAAGCAGAGCTTATCCC

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT037977.2
NONMMUT037978.2
NONMMUT037979.2
NONMMUT037982.2

Data Sources

Source NameOld Id
NONCODEv3n414374
gencodeENSMUST00000145799.1
PMID26117828TCONS_00006735
NONCODEv4NONMMUT037980
PMID26117828PNCT_MMU153536
ensemblENSMUST00000145799
refseqNR_027899
NAMEHoxd3os1