An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037988.1

General info


NONCODE TRANSCRIPT IDNONMMUT037988.1
NONCODE Gene IDNONMMUG023454.3
Chromosomechr2
Start Site74749873
End Site74753827
Strand-
Exon Number4
CNCI Score-0.0143360
Length1562
Assemblymm10
Other transcript VersionsNONMMUT037988.1(old version)

Sequence


>NONMMUT037988.1
TCTAGATGAACTTTCCAAAAAGCTGAAGTAAAATACTTACTGGTCTTGCTGCTGCATTAGACAGGAAAGATGTTGTGAGTGATGTGATGAATATATACATACTTTTATTGTAACTTTAAAGGGAATTCAAGTTTACTCCAAGTTCAGTGGCCGCTTTGACCTACTTACTCCCACGCAGAGAGGCCTGCAGGCAGACTTGGGGTCAATAAGAAACCTTGATTCATTGGGACTGTTCTTGCCCTGCCTTCAGAAAGAGTTTCCCTTTCTAGAAATAGAGCGGCTTGTGTGAGTGTCACTGGGATAGGAGGGAGAATGCCGGGTCACAATGGGTCGGGGGACAGCGTGGGTGTAGATTTGCTATGAAGTTCGAGGTCCGTGCTGGAGGGCTGCGGTTAGAGCTGAGAAGTAAGCAGTGGCCCTCCCTTCGGTGCCGCACAGAGATGTCCACCGACCTTCCCCTCCTGCGTGCCTGGAGCGCTATCCTGGGCAGCCGCAGGACTGTGTGTCGCCCCCTCCCTCAGCGCTCACCCGGAGCGCCCGCGTCTCCTTCGCTTGCGGTTTCTGGTCGGCTCCCAGCTGGCCCAGACTTGCTCTAAAGTAGGAGGAACCGCTGTCGAGCGAAAAGTGCACACCGGCACCAACAAAGCAGGAAGGGCAGAGGATTCATCCATCAGGCCTTGTGCTATCCATCCAGACTTTCTGAGAGAGAAATCTACAAGAGCCAGCCCTTAAAAGTGTGGCTTAGTTTCTCAAAGAAGGACCAAAGTTTTGTCAAGAACACCCAGATGAAGACCTTCCTAGACCTGTAAACTGGGATTACCAAGTTCTTGACTTCACAAGGAAGTTTCAACCAATTCTGACCTAATACTCTACCGGAGATCCACAACCTTCCTAATCCCCACCCCCTCCTCGTCCCGCCCCCGCGCCTCAAAAACTATGGAGAAAAAGAAGGTGTGCCCAAGGCTGGACCGAAGTCATCCTGCCCCTTCTTCAAAAGAGAGACACCTCCCAAGGCCAACGCCCTCCGGAGGGGCCCAGGTGCTCCTCCCTTCTGGCATCTATTCCGTCTGGCATCTATTCCGTCTGGCATCTATTCCTCTGCAAAGGATCAGAAAGGAAGCCGCTGGCTCAATGGATTCTGGATTTCGGGTAGACCTGACTGCTTTGGGGCATCCTCAATCGGGCGGTGAAGCCTCTGGGGGCAGAGGAGCGTCGTGGGAGAGGAGCGTCGTGGGAGAAAGACAAGCTAGGCTGCTGCTTCCCTACCCATGCCAACTTCCCGGGTCTCGTCTTGAAACAAGAGCAGAGGCCTGAGACCCGGGCGCCATTGCTGGCCAGGCTCCCCTCCCCCACACTCCTTTCTTTGCTTCTCGAAGACCCGGGAGGGAGGAGGCGGCGAGCGCCTCGGTGGATAGAGCTGCTATTGTGACCTTCCCGGGCTAAGCGGGGAACCCAGCGGAGTGTGTACTGCCCGCGGTGGCGGGGGAGGAGGTGACTGTGTGCAAGCCTCGAGTGCAGAGGGGGTGGCACCCGGGAATAAATAAAGGCTTGCAACCTCGGGC

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT037986.2
NONMMUT037987.2
NONMMUT037989.2
NONMMUT037990.2
NONMMUT109226.1
NONMMUT146847.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00007350
NONCODEv4NONMMUT037988
PMID26117828PNCT_MMU019907