An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037989.1

General info


NONCODE TRANSCRIPT IDNONMMUT037989.1
NONCODE Gene IDNONMMUG023454.3
Chromosomechr2
Start Site74749873
End Site74754032
Strand-
Exon Number4
CNCI Score-0.0376832
Length1156
Assemblymm10
Other transcript VersionsNONMMUT037989.1(old version)

Sequence


>NONMMUT037989.1
GCTTACATAACTGAAGAAGCATTTCAGCCAGAGAAAAGGGCACAAAGGGGACCAGGCCAAAGCTTTTGTAATTTACAGAGAGCATTTGTCACTCCGGAAGTGGTATAGGAGTGTGTTACCACCTACTCGACCCAAAACGGACCTGGTGCAAACAACTCCAAGCACCAACAAAGCAGGAAGGGCAGAGGATTCATCCATCAGGCCTTGTGCTATCCATCCAGACTTTCTGAGAGAGAAATCTACAAGAGCCAGCCCTTAAAAGTGTGGCTTAGTTTCTCAAAGAAGGACCAAAGTTTTGTCAAGAACACCCAGATGAAGACCTTCCTAGACCTGTAAACTGGGATTACCAAGTTCTTGACTTCACAAGGAAGTTTCAACCAATTCTGATGGAACAACCAGAGAGGCCCAAATGACTGCCACCCATGAGCCAAGGACCTGATCTCTTTCCTTTAGACCTAATACTCTACCGGAGATCCACAACCTTCCTAATCCCCACCCCCTCCTCGTCCCGCCCCCGCGCCTCAAAAACTATGGAGAAAAAGAAGGTGTGCCCAAGGCTGGACCGAAGTCATCCTGCCCCTTCTTCAAAAGAGAGACACCTCCCAAGGCCAACGCCCTCCGGAGGGGCCCAGGTGCTCCTCCCTTCTGGCATCTATTCCGTCTGGCATCTATTCCGTCTGGCATCTATTCCTCTGCAAAGGATCAGAAAGGAAGCCGCTGGCTCAATGGATTCTGGATTTCGGGTAGACCTGACTGCTTTGGGGCATCCTCAATCGGGCGGTGAAGCCTCTGGGGGCAGAGGAGCGTCGTGGGAGAGGAGCGTCGTGGGAGAAAGACAAGCTAGGCTGCTGCTTCCCTACCCATGCCAACTTCCCGGGTCTCGTCTTGAAACAAGAGCAGAGGCCTGAGACCCGGGCGCCATTGCTGGCCAGGCTCCCCTCCCCCACACTCCTTTCTTTGCTTCTCGAAGACCCGGGAGGGAGGAGGCGGCGAGCGCCTCGGTGGATAGAGCTGCTATTGTGACCTTCCCGGGCTAAGCGGGGAACCCAGCGGAGTGTGTACTGCCCGCGGTGGCGGGGGAGGAGGTGACTGTGTGCAAGCCTCGAGTGCAGAGGGGGTGGCACCCGGGAATAAATAAAGGCTTGCAACCTCGGGC

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT037986.2
NONMMUT037987.2
NONMMUT037988.2
NONMMUT037990.2
NONMMUT109226.1
NONMMUT146847.1

Data Sources


Source NameOld Id
PMID26117828PNCT_MMU019908
PMID26117828TCONS_00007351
NONCODEv4NONMMUT037989