An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037990.1

General info


NONCODE TRANSCRIPT IDNONMMUT037990.1
NONCODE Gene IDNONMMUG023454.3
Chromosomechr2
Start Site74748421
End Site74762896
Strand-
Exon Number3
CNCI Score-0.0249856
Length2454
Assemblymm10
Other transcript VersionsNONMMUT037990.1(old version)

Sequence


>NONMMUT037990.1
CGCGCCTGCCTTGCTGCCAACTTAGCCAAAGTGGCTGAGGGGCCTCCGCCCAGCTCGGGGGAGAGCGGCGCCGGCGGAAGGGCGGGGCGAGAGCCCTGGACATCAGCTCCTGGGACAGTTTCTCAAAGAAGGACCAAAGTTTTGTCAAGAACACCCAGATGAAGACCTTCCTAGACCTGTAAACTGGGATTACCAAGTTCTTGACTTCACAAGGAAGTTTCAACCAATTCTGATGGAACAACCAGAGAGGCCCAAATGACTGCCACCCATGAGCCAAGGACCTGATCTCTTTCCTTTAGACCTAATACTCTACCGGAGATCCACAACCTTCCTAATCCCCACCCCCTCCTCGTCCCGCCCCCGCGCCTCAAAAACTATGGAGAAAAAGAAGGTGTGCCCAAGGCTGGACCGAAGTCATCCTGCCCCTTCTTCAAAAGAGAGACACCTCCCAAGGCCAACGCCCTCCGGAGGGGCCCAGGTGCTCCTCCCTTCTGGCATCTATTCCGTCTGGCATCTATTCCGTCTGGCATCTATTCCTCTGCAAAGGATCAGAAAGGAAGCCGCTGGCTCAATGGATTCTGGATTTCGGGTAGACCTGACTGCTTTGGGGCATCCTCAATCGGGCGGTGAAGCCTCTGGGGGCAGAGGAGCGTCGTGGGAGAGGAGCGTCGTGGGAGAAAGACAAGCTAGGCTGCTGCTTCCCTACCCATGCCAACTTCCCGGGTCTCGTCTTGAAACAAGAGCAGAGGCCTGAGACCCGGGCGCCATTGCTGGCCAGGCTCCCCTCCCCCACACTCCTTTCTTTGCTTCTCGAAGACCCGGGAGGGAGGAGGCGGCGAGCGCCTCGGTGGATAGAGCTGCTATTGTGACCTTCCCGGGCTAAGCGGGGAACCCAGCGGAGTGTGTACTGCCCGCGGTGGCGGGGGAGGAGGTGACTGTGTGCAAGCCTCGAGTGCAGAGGGGGTGGCACCCGGGAATAAATAAAGGCTTGCAACCTCGGGCACTTGGACCCTTCGGAGAGCGTTTGGTTGTGTTTAGACTTGGGTGCTTCCTAACACTAATTGCAGGCTCAAGAGGAGCGGAATTTATGGCGAAGGCCAAGGCGGCTTGTTTATAATTTATGAAGTTTTAAATGGTTGTGCCGCGGGCCCAGCTCTCTCCGGCGGGCGGCCGCGTGGGAGTGTGCCCTCCCAGAACTCGCCGCCGCCCCCACCCACGCTAGGAGTGAGTGTGCCTGTCACGTGACTCGCGTTGGTGGCAGGAAAGAACCAAGCAATTCTCTGAAGTCTCCAGAACTTCAGAAGGTAGGCGAAGGCGGCAGGTTTGGTCGAAGCGACCCCTCCCCCTTCTTCCAACATCCTCCCTCCACCGCCGGGCCTGTGAGGTTGCGGCTGCCTAGACGGTGGGAACCCCCAACCTGACACTTCCTTAGAGCCTATGTGTGAGAGGAAGCTGATGTCAGCCGGGCTAGACACTGTTTAAAGTAATCCATGAAACCCTAAGCCACAGATGACGCTTGGGGTATTGCAGACACCCGCAGACTCAGCAGATACTCCTGTGGTAACACACCGCGCTGGGAAACGCCTGGAGCCATGATGCATTATGTATTTTTATTATTATTTATGGTATGAAGAGGAGATGAGAGAAACCGGGCTGAATCTAAACAGCCTGACAATTCATCTATTTAATATTTAGCCAGTTAAGAAAGGTGGCTGTGGTTCCCTACGAGGCAGCTAGCATTTCTTTGATTTCCGTAATAGCTTAAAAAATAATTTCTTACAATTATAAATTCTGTCTAGGAATGCAAATTTCAGAGAAAACAATGTTAAGCCTTGAGAGTGGGTAAAATATGCCTTCGATTGAAGTCATTTATTCTGTTGATACAATTCTACAACATATATACTTTAAACTTGCTCAGATAGAGTGAAATTTAGCAAAAGGATAACCCCTCCCACCCCCAGCCTAACATGCCATTTTTAAAACAGCACAAAGGAACAAGGAAACTAAATATTCTTTTGAGCCATCATTACTGAGCGAAACACAAACATCCAAATAGAAAACGATTGCTGTTGCACCAGAAGAGTAGAAGTTATCTCCACACAATGGGAATTTCACCTCGTGTCACCAGGCTGGTAGTGGGAGTTGCATATTTGCCAAACCAACTAGAGATGCGTGGGTGGACTTTGCTGAAATACAAAATAATTGAACCTTGTCTGAAGGCCTTTTTCCAAGTGCTCCCTTCTATAGAAGTGGGTGTAAGTGCTCGACCCTTCCTAGAGCCACACTAATAATATTTACAAAACGATTATAAATTCTGTAGACTATTCGCCCATTTTGCACAAAGAAACAGGAGTAAGCAAGGTGTTTATACGTGTTGTGTTCTATTAATGAACCTTTCGTTATTTTACATTGTGAAGAATGTTTGTTTTCTTTAAAAGTGAACTGCTGACCACT

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT109226.1
NONMMUT146847.1
NONMMUT037986.2
NONMMUT037987.2
NONMMUT037988.2
NONMMUT037989.2

Data Sources

Source NameOld Id
PMID26117828TCONS_00006738
PMID235831TCONS_00017754
ensemblENSMUST00000152462
refseqNR_110445
NAMEHaglr
NONCODEv4NONMMUT037990
gencodeENSMUST00000152462.1
PMID26117828PNCT_MMU019909