An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT038364.1

General info


NONCODE TRANSCRIPT IDNONMMUT038364.1
NONCODE Gene IDNONMMUG023701.2
Chromosomechr2
Start Site88572051
End Site88579744
Strand+
Exon Number2
CNCI Score-0.0049152
Length743
Assemblymm10
Other transcript VersionsNONMMUT038364.1(old version)

Sequence


>NONMMUT038364.1
GCAGTCACCGCCTCAGAGAACTTGGCTGTGCCTCCCATATACGCTGATCTTGGCAAGTCTGTCAGGGATGTCTTCACCAAGGCTTTGGCTTAATAAAACTTGATTTGAAAACAAAGTCAGAGATGGATTGGTATTTACCAGCTCAGGCTCTGCCAAGAAGGAAACCATCAAAGTGAACAGCAGCCTGGAAACCAAGTACAGATGGACTGATGTTTACAGAGAAGTGGAACAGAGGCAAAACCCTGGGCACTGAGATCACTGTGGAAGACCAGCTTGCTCGTGAACTGAAGCTGACCTTTGATTCATCTTTCTCACCTAACACTGAGGAGGAGAAGGGAATTGCTAAAATCAAGACAGGGTACAAGAGGGAGCTTATCAACCTTGGCTGTGATGTGGGCCCTCAGTCCGGGGCACTATGGTGCTTGGCTATGAGGGTTGGCTGGCTAGCTACCAGATGAATTTTGAGACCTTGAAGTCCCGTGTGACCTAAAGTAACTTTGCAGTTGGCTACAAGGTGGAAGAATTCCAGTTTCATACTAATGTGATCTACAGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGTTTTTTGGCCAAAGGGAAAACTCCATCCTGATTGGCTTAAGGTACACTCAGACCCTAAAAACAGAAATCAAACTGATGTTGTCAGCCCTGCTGGAATGGCAAGAACGTCAATATGGGCAGCCACGAGCTTGGCCTAGGACTGGCATTCCAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU020158
ensemblENSMUST00000118699
NONCODEv4NONMMUT038364