An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT048288.1

General info


NONCODE TRANSCRIPT IDNONMMUT048288.1
NONCODE Gene IDNONMMUG029944.2
Chromosomechr4
Start Site99650412
End Site99651785
Strand+
Exon Number2
CNCI Score-0.0290816
Length496
Assemblymm10
Other transcript VersionsNONMMUT048288.1(old version)

Sequence


>NONMMUT048288.1
TGGGGATCTGCCCCCAAGGCTAGGAGGGCAGGACAGAGTAGCGATGTGGAGAATTCGATGTCCGAGCGACCTCCTCGGAGGAGTGGATCGAGTTAAATATAACTGCGCGAATGGAATGGCGCTAAAAATAAGAATGATCCCGCGTGATGAAGTGTCGGCTCCGAAGGGGGTGAAAATGGTGAATTCCTAAAAACCCAGCCCTCGGCTTCTCCAGCAGCTACCGTTAGCCTGGAGGGACCCAGCGGACGCCGGGCCCGCGGTGTCGCATCGAACTGCGTCGGCAAGACTCTAGCTTGCAATGCCAAGTCATTTTTAAGCCCTGATCCTGCCCAGAATCTTTCTCCTCGCGAATGAAAAGAACAATTTTCGAGAGAAAGGCTCGTTTTGATTAAATCTGACATGCTGCTGATAACTCCATGCTAATGTGAAATAATTAACATAATAGCCATAATTAAAAGCACGCTAACAATGCCATAAATTTATCACACAATTTTAC

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT048288
PMID26117828PNCT_MMU025521
PMID23583100TCONS_00022674