An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT048455.1

General info


NONCODE TRANSCRIPT IDNONMMUT048455.1
NONCODE Gene IDNONMMUG030068.2
Chromosomechr4
Start Site105374453
End Site105374946
Strand-
Exon Number1
CNCI Score-0.1257472
Length493
Assemblymm10
Other transcript VersionsNONMMUT048455.1(old version)

Sequence


>NONMMUT048455.1
GAAGAAGGAGAGTAAAGTCAGCATGAGCAAAAATTCGAAGCTCCTGTCCACCAGCACCAAGAGGATCCAGAAGCAGCGGGCAGGCATCACTTTAGACCCTCTGCCAAACTGCAGTGTTGGTCCCAAGGGTGACAACATCTATGAGTGGAGATCAACCATTCTGGGTCCTCCAGGGTCTGTGTGTGAAGGTGGAGGATTCTTCCTTGACATTACTTTTACCCCAGAGTATCCCTTCAAGCCTCCAAAGGTTACATTTCGTACAAGAATGTATCACTGTAATATTAATATCCAAGGAGTTATTTGCTTAGACATATTGAAAGACAACTGGAGCCCAGCACTAACCATCTCTAAAGTCCTCCTTTCTATCTGCTCACTCTTTACAGACTGCAATCCTGCTGACCCTTTGGTGGGAAGTATTGCCACTCAGTACATGACCAACAGAGCAGAACACGACAGAATGGCCAGACAGCGGACCCAGAGATACGCTACATAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT048455
ensemblENSMUST00000118507