An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053204.2

General info


NONCODE TRANSCRIPT IDNONMMUT053204.2
NONCODE Gene IDNONMMUG033049.2
Chromosomechr5
Start Site97392416
End Site97642179
Strand+
Exon Number5
CNCI Score-0.0249856
Length570
Assemblymm10
Other transcript VersionsNONMMUT053204.1(old version)

Sequence


>NONMMUT053204.2
AGCCCGTGAGGCTTCCTGTTCTCAGGCCTCAGTATGTTCACATTTGGGAAAGGGCGGAGCGAGAGGAGCTGAGTCCTTCTCGGTTTAAAAGCGTCTCTCCAACTTTTCCACTGAAGAGTGAATCCAGAGCCTCTCTCCCACCAAGATACTGCTGTCTTTCCAGACCTCCTAATGCTAACTTTTTAAACAGACATGAATTGCTTGCTTTTTGAATTTTGAGAAGATACTCTGGAAAAGATCTAGCAAGATGGCAGAAGCACATATGGAAGACTATGAAGTTCTTGGAGAGACTCCGCAGCATTGTTCATAATGGCTGTTCACAGCAAACAGGTAATGCTCAGCATCTTCTTGCAGAGGAAGGAGCGTCGCGTCGTGAGCCCACCCGAGGGTCTCCAAGCCACTGCTAGGAGCAGTGTGCACTCCGACCCTGATCGTGGGCCGGTGTCCTGGCTTATCTCCCTTAAGAATTCATCTGTCCTCCAGAAACTACAAGTCATGGGTGTTCTCATTCCTTCCATTTCTATAATTTGCAGGACCTTCCAGGCCGAGAGAAAATAAAGCCAATTCTAG

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
000000
Loading...


Isoforms


Transcript ID
NONMMUT053203.2
NONMMUT053205.2
NONMMUT053206.2
NONMMUT053207.2
NONMMUT053208.2
NONMMUT118795.1
NONMMUT118796.1
NONMMUT118798.1
NONMMUT118799.1
NONMMUT118800.1

Data Sources


Source NameOld Id
NONCODEv4NONMMUT053204
PMID26117828PNCT_MMU193521
noncodeV3n292734
ensemblENSMUST00000181724
gencodeENSMUST00000181724.4