An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053205.1

General info


NONCODE TRANSCRIPT IDNONMMUT053205.1
NONCODE Gene IDNONMMUG033049.1
Chromosomechr5
Start Site97821435
End Site97863091
Strand+
Exon Number3
CNCI Score-0.1476802
Length379
Assemblymm9
Other transcript VersionsNONMMUT053205.2

Sequence


>NONMMUT053205.1
AGCCCGTGAGGCTTCCTGTTCTCAGGCCTCAGTATGTTCACATTTGGGAAAGGGCGGAGCGAGAGGAGCTGAGTCCTTCTCGGTTTAAAAGCGTCTCTCCAACTTTTCCACTGAAGAGTGAATCCAGAGCCTCTCTCCCACCAAGATACTGCTGTCTTTCCAGACCTCCTAATGCTAACTTTTTAAACAGACATGAATTGCTTGCTTTTTGAATTTTGAGAAGATACTCTGGAAAAGATCTAGCAAGATGGCAGAAGCACATATGGAAGACTATGAAGGTAAAATACCCGAGAAACAGTGCAAAGGCAAACAAGTCTATCAATGGCAGAGCTGTGGACCTGTGAATGTGAGCAGTGTTTCTCACCTAATCCTGGCAGGA

Expression Profile


NA

Isoforms


Transcript ID
NONMMUT053203.1
NONMMUT053204.1
NONMMUT053206.1
NONMMUT053208.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00009520
PMID26117828PNCT_MMU028350
NONCODEv4NONMMUT053205