An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053205.2

General info


NONCODE TRANSCRIPT IDNONMMUT053205.2
NONCODE Gene IDNONMMUG033049.2
Chromosomechr5
Start Site97392416
End Site97434072
Strand+
Exon Number3
CNCI Score-0.0573440
Length379
Assemblymm10
Other transcript VersionsNONMMUT053205.1(old version)

Sequence


>NONMMUT053205.2
AGCCCGTGAGGCTTCCTGTTCTCAGGCCTCAGTATGTTCACATTTGGGAAAGGGCGGAGCGAGAGGAGCTGAGTCCTTCTCGGTTTAAAAGCGTCTCTCCAACTTTTCCACTGAAGAGTGAATCCAGAGCCTCTCTCCCACCAAGATACTGCTGTCTTTCCAGACCTCCTAATGCTAACTTTTTAAACAGACATGAATTGCTTGCTTTTTGAATTTTGAGAAGATACTCTGGAAAAGATCTAGCAAGATGGCAGAAGCACATATGGAAGACTATGAAGGTAAAATACCCGAGAAACAGTGCAAAGGCAAACAAGTCTATCAATGGCAGAGCTGTGGACCTGTGAATGTGAGCAGTGTTTCTCACCTAATCCTGGCAGGA

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
0000.11233200.173247
Loading...


Isoforms


Transcript ID
NONMMUT053203.2
NONMMUT053204.2
NONMMUT053206.2
NONMMUT053207.2
NONMMUT053208.2
NONMMUT118795.1
NONMMUT118796.1
NONMMUT118798.1
NONMMUT118799.1
NONMMUT118800.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00009520
PMID26117828PNCT_MMU028350
NONCODEv4NONMMUT053205