An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053207.1

General info


NONCODE TRANSCRIPT IDNONMMUT053207.1
NONCODE Gene IDNONMMUG033049.2
Chromosomechr5
Start Site97455133
End Site97496377
Strand+
Exon Number2
CNCI Score-0.0061440
Length1451
Assemblymm10
Other transcript VersionsNONMMUT053207.1(old version)

Sequence


>NONMMUT053207.1
GTTTTTCTAATGTGTTCTCTTTATTCAAAACCTTTATTTTAAGGAGTATTTGTAGGGGCCTCATGGGTTCCTGTAAGCAAGTGGCCTATAGGTAAAAATAAACCTATAATATTGGTTTCACACTAAAAGATGGAATTCTTTCTGTAAAAAGTTCACACATTGCAAGTCCGTGGTTCAAATTACTCTTCAGCAGTTGAGACACATCTTGCTCCAATTAATAACGTCATGCTACTCACTATAAAAAAACCCAAGGGCAGACAAGAGAAGACAGGGTTATCGCCATTTTCAGGGTCCTTTGCTGTAACCCAACCCATTGACTTCATCACTGCTCTCTTCCATGTTGAAAAACGAATTTCACTCTCTGTGGCTTGGATTTGTGGTTCATATCGTTCCATCAAGATCGTAGACAAATCTTCAGGTTCAAGACTCCAAACATTTACCCCTTCTGCAGCTCCGGCTGCCATGGCAGCTCCCAGGGCCGTCGTTTCAGGCATGACAGACTTAACTACCGGAATGTGCAGAATATCTGCCTGTAGCTGCATAAGAATCCTGTTGTTGGTCATTCCTCCATCGACCTGCAAATGACTGAGTGGAATTCCACAGTCGCGATTCATGGCATCCAAAATCTCTCGGGTTTGGAAACAAACAGCTTCTAACGCAGCAAAGGCAATATGGCATTTGTTGGTGAACTGAGTGAGACCACAGATTATCCCTCTTGCACTGGGTTCCCAGTAAGGTGCATACAGCCCCGAAAAGGCTGGGACAAAGTAGCAGCCATAGGAAGTGCCTACCTCTCTTGCAAGATTTTCAACTTCCCCTGAGGTTGTTATAATTTCGAAATTGTCTCTTAGCCAGCGAATAACAGCACCAGCTATAGCAACAGAACCTTCTAAGGCATAAAAAACTGGCTTATTTTTGCCTAGTTTGTAAGCCAATGTGGTCAGAAGGCCATGTTCAGAAAACACACATTTCTGGCCTGTATTACATAGTAAAAAACAGCCTGTTCCGTATGTGTTTTTGGCTTGACCTTCATGGAAACACATTTGTCCCACTAAAGCAGCAGACTGATCCCCCAAACATCCAGATATTGGCACGCCTTCCAAGGCCCCTGATGTCATCAGGCCATAGATCTCAGAAGAACTGCATACATTTGGGAGGATGCTCATTGGAATTTCAAAAAAGTCACAGAGATCTTTATCCCATTCCAAAGAGTGGATGTTAAAAAGCATCGTTCTGCATGCATTTGTTACATCGGTGCAATGGATGCCTCCATTGACTCCTCCGGTCATACACCAGATGAGCCAAGAGTCGATGGTTCCAAACATGGCTCTGCCTTCCTCAACAGCCTTTTGAATGGGTCTTAGGTTGTCCAGCATCCACCGCAGCTTCACAGCACTGAAACCAGTAATCAGGTTGCCAATTTGTCAAGTCTACAAGATAATGAATATGGG

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT053203.2
NONMMUT053204.2
NONMMUT053205.2
NONMMUT053206.2
NONMMUT053208.2
NONMMUT118795.1
NONMMUT118796.1
NONMMUT118798.1
NONMMUT118799.1
NONMMUT118800.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00009521
NONCODEv4NONMMUT053207
PMID26117828PNCT_MMU028351