An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053207.1

General info


NONCODE TRANSCRIPT IDNONMMUT053207.1
NONCODE Gene IDNONMMUG033050.1
Chromosomechr5
Start Site97884152
End Site97925396
Strand+
Exon Number2
CNCI Score-0.0154246
Length1451
Assemblymm9
Other transcript VersionsNONMMUT053207.2

Sequence


>NONMMUT053207.1
GTTTTTCTAATGTGTTCTCTTTATTCAAAACCTTTATTTTAAGGAGTATTTGTAGGGGCCTCATGGGTTCCTGTAAGCAAGTGGCCTATAGGTAAAAATAAACCTATAATATTGGTTTCACACTAAAAGATGGAATTCTTTCTGTAAAAAGTTCACACATTGCAAGTCCGTGGTTCAAATTACTCTTCAGCAGTTGAGACACATCTTGCTCCAATTAATAACGTCATGCTACTCACTATAAAAAAACCCAAGGGCAGACAAGAGAAGACAGGGTTATCGCCATTTTCAGGGTCCTTTGCTGTAACCCAACCCATTGACTTCATCACTGCTCTCTTCCATGTTGAAAAACGAATTTCACTCTCTGTGGCTTGGATTTGTGGTTCATATCGTTCCATCAAGATCGTAGACAAATCTTCAGGTTCAAGACTCCAAACATTTACCCCTTCTGCAGCTCCGGCTGCCATGGCAGCTCCCAGGGCCGTCGTTTCAGGCATGACAGACTTAACTACCGGAATGTGCAGAATATCTGCCTGTAGCTGCATAAGAATCCTGTTGTTGGTCATTCCTCCATCGACCTGCAAATGACTGAGTGGAATTCCACAGTCGCGATTCATGGCATCCAAAATCTCTCGGGTTTGGAAACAAACAGCTTCTAACGCAGCAAAGGCAATATGGCATTTGTTGGTGAACTGAGTGAGACCACAGATTATCCCTCTTGCACTGGGTTCCCAGTAAGGTGCATACAGCCCCGAAAAGGCTGGGACAAAGTAGCAGCCATAGGAAGTGCCTACCTCTCTTGCAAGATTTTCAACTTCCCCTGAGGTTGTTATAATTTCGAAATTGTCTCTTAGCCAGCGAATAACAGCACCAGCTATAGCAACAGAACCTTCTAAGGCATAAAAAACTGGCTTATTTTTGCCTAGTTTGTAAGCCAATGTGGTCAGAAGGCCATGTTCAGAAAACACACATTTCTGGCCTGTATTACATAGTAAAAAACAGCCTGTTCCGTATGTGTTTTTGGCTTGACCTTCATGGAAACACATTTGTCCCACTAAAGCAGCAGACTGATCCCCCAAACATCCAGATATTGGCACGCCTTCCAAGGCCCCTGATGTCATCAGGCCATAGATCTCAGAAGAACTGCATACATTTGGGAGGATGCTCATTGGAATTTCAAAAAAGTCACAGAGATCTTTATCCCATTCCAAAGAGTGGATGTTAAAAAGCATCGTTCTGCATGCATTTGTTACATCGGTGCAATGGATGCCTCCATTGACTCCTCCGGTCATACACCAGATGAGCCAAGAGTCGATGGTTCCAAACATGGCTCTGCCTTCCTCAACAGCCTTTTGAATGGGTCTTAGGTTGTCCAGCATCCACCGCAGCTTCACAGCACTGAAACCAGTAATCAGGTTGCCAATTTGTCAAGTCTACAAGATAATGAATATGGG

Expression Profile


NA

Data Sources


Source NameOld Id
PMID26117828TCONS_00009521
NONCODEv4NONMMUT053207
PMID26117828PNCT_MMU028351