An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053705.1

General info


NONCODE TRANSCRIPT IDNONMMUT053705.1
NONCODE Gene IDNONMMUG033328.1
Chromosomechr5
Start Site110263184
End Site110264602
Strand+
Exon Number2
CNCI Score-0.1013164
Length908
Assemblymm9
Other transcript VersionsNONMMUT053705.2

Sequence


>NONMMUT053705.1
cttggtaataattttgacatgcaaaggctttgccacattgcttacattcatagggtttctctccagtatgtgttcttttatgtacttggtaataattttgacatgcaaaggctttgccacattgcttacattcatagggcttctctccagtatgtgctcttttatgtacttcgaaccttccatgatatgcaaagcctttaccacactgatcacatttgtaaggtttctcttcagtatgtgttgttattttatgcactttgagattaccttggagtgaaaaggctttgccacactgatcacatttgtaaggtttctctccagtatgaattctttcatgtattcgaagttgaccatgagaagcaaaggttttactacattgattacattcatagggtttctctctagtatgtgttctttcatgtattcgaagttgaccatgacaagcaaaggttttactacattgattacattcatagggtttctcttcagtatgaattctttcatgcattcgaagttgaccaggacaagcaaaggatttactacattgattacattcatagggtttgtgttcagtatgcattcttttatgcattcgaagattaccagggtatacaaaggctttagaacattgattacatttgtaagatttccctcgagtatgaattctttcatgttttcgaagttgaccatgagaagcaaaggatttactacattgcttacattcatacggtttctctccactatgtgttctttcatgtatttggagagtatggggtcctgcataggctttaccacattgattgcatttgtagcgtttctctccagtgtgtgttattttccaaattcggaaactactatgatgaacaaaggcttcactgcactgaatgccttcatagggattctctcca

Expression Profile(Data Source:)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU028647
PMID23583100TCONS_00025053
NONCODEv4NONMMUT053705