An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT053705.2

General info


NONCODE TRANSCRIPT IDNONMMUT053705.2
NONCODE Gene IDNONMMUG033328.2
Chromosomechr5
Start Site109834165
End Site109835583
Strand+
Exon Number2
CNCI Score-0.0413696
Length908
Assemblymm10
Other transcript VersionsNONMMUT053705.1(old version)

Sequence


>NONMMUT053705.2
cttggtaataattttgacatgcaaaggctttgccacattgcttacattcatagggtttctctccagtatgtgttcttttatgtacttggtaataattttgacatgcaaaggctttgccacattgcttacattcatagggcttctctccagtatgtgctcttttatgtacttcgaaccttccatgatatgcaaagcctttaccacactgatcacatttgtaaggtttctcttcagtatgtgttgttattttatgcactttgagattaccttggagtgaaaaggctttgccacactgatcacatttgtaaggtttctctccagtatgaattctttcatgtattcgaagttgaccatgagaagcaaaggttttactacattgattacattcatagggtttctctctagtatgtgttctttcatgtattcgaagttgaccatgacaagcaaaggttttactacattgattacattcatagggtttctcttcagtatgaattctttcatgcattcgaagttgaccaggacaagcaaaggatttactacattgattacattcatagggtttgtgttcagtatgcattcttttatgcattcgaagattaccagggtatacaaaggctttagaacattgattacatttgtaagatttccctcgagtatgaattctttcatgttttcgaagttgaccatgagaagcaaaggatttactacattgcttacattcatacggtttctctccactatgtgttctttcatgtatttggagagtatggggtcctgcataggctttaccacattgattgcatttgtagcgtttctctccagtgtgtgttattttccaaattcggaaactactatgatgaacaaaggcttcactgcactgaatgccttcatagggattctctcca

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
1.626212.137671.134243.182140.1250670.479646
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU028647
PMID23583100TCONS_00025053
NONCODEv4NONMMUT053705