An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056939.2

General info


NONCODE TRANSCRIPT IDNONMMUT056939.2
NONCODE Gene IDNONMMUG035346.2
Chromosomechr6
Start Site52158521
End Site52162283
Strand+
Exon Number2
CNCI Score-0.0598016
Length518
Assemblymm10
Other transcript VersionsNONMMUT056939.1(old version)

Sequence


>NONMMUT056939.2
AGCGGCCGCTCCCGGAGCTGACTTGGAGCACTGGGACCAAAGGGAGTCGAGACTGCCTTCTGCGCGCGCCCGGCTTTGCGCGCCTCCGCCACCAGATGTGGGGGGATGGGAGGCCCCCTCCGCGGCCCCTTCCCCACCCAGCCCAGAAAGCTGAACTGGCAAGAGGTCTGTTTTTCCTGAACCCATCCACAGCTGGGAGATTAATCAACCACACTGAAAATGGGGGTGTGGGGGAGGGAAAGGAAGAGTTGGAACGTAGATGTTTGAAACAAATGTGTATAAATAAATGAATTTTTGATAACTCCGTTATTGACCTAGAAACTAGCAGCTTGGTAAGGGAACTCCATTCCACTCCACTCGTCCTAGAACTGGAAGTTTTTGTAGGCACTTTTCCTCTCCACACTCAAAAGCTTGGGCTAGGGCCAACTCAGGCTGCCCAAGCCCATTTCTATTACTAATGTAACTCTATGGCCTGAGTCTCAACACTGAAAACCAAATTCATTCCCTTAGGGGGGAAA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
00.91188919.11262.9687700
Loading...

Isoforms

Transcript ID
NONMMUT122271.1
NONMMUT056937.2
NONMMUT056938.2

Data Sources

Source NameOld Id
refseqNR_131181
NAMEHotairm1
gencodeENSMUST00000159006.1
NONCODEv3n344146
PMID235831TCONS_00027098
NONCODEv4NONMMUT056939
ensemblENSMUST00000159006
PMID26117828PNCT_MMU203491
PMID26117828TCONS_00010114
NONCODEv3mouse