An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056945.1

General info


NONCODE TRANSCRIPT IDNONMMUT056945.1
NONCODE Gene IDNONMMUG035350.2
Chromosomechr6
Start Site52172880
End Site52174059
Strand+
Exon Number2
CNCI Score-0.0716800
Length552
Assemblymm10
Other transcript VersionsNONMMUT056945.1(old version)

Sequence


>NONMMUT056945.1
AGCAGCACGACGTGGCCCCGGGCGCAGGGAGCCGCACTATAAAAAGCTGCTGGAATTTACTGGCAGCTACAAATATTTGCTTAACTTGCGTCTGGAGTTGGGGGATTTTCCGCGGAGCAGCAGAACCAGCAATTTGAAACAAGCCACTCCAACCTCTTTTTCAAAGTTATAGGAGGTTCCCTGTCTTGAAGTCTCCTGCCTTGGATTTTCTGAGGTGCTGCTATTCTGGGCAACTATCAAAATCCTACCTGTTAAAACATGATGGATTAGAGAAAAAAAACAACCCACCAGGAACCTGAAAAACCGGCGTTCATCTCCATGACCACGGCTTGAACTCTCCTTCCAACTTAACGATAATAGGTTCTGTCTTAGAAACTGCTATGTAATTTGATGTATGGGGGTCATTTGGCTCCAGAGGAGGCATGGAAGCACAAACCATAAACTCCTGCCAGACTTCCCTGATCTTTGTATACTTTTGTTGGTCATATTTGTTATTTGGTCCATTTTCCTGCTTCAGAAATACTAAGTAAAGAAAAACATCTTTTTAAAAAA

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT122274.1

Data Sources


Source NameOld Id
NONCODEv3n270669
PMID26117828PNCT_MMU203495
PMID26117828TCONS_00010117
PMID235831TCONS_00027101
ensemblENSMUST00000133723
NONCODEv4NONMMUT056945
gencodeENSMUST00000133723.1