An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056946.1

General info


NONCODE TRANSCRIPT IDNONMMUT056946.1
NONCODE Gene IDNONMMUG035351.2
Chromosomechr6
Start Site52175216
End Site52193020
Strand+
Exon Number2
CNCI Score-0.0286720
Length575
Assemblymm10
Other transcript VersionsNONMMUT056946.1(old version)

Sequence


>NONMMUT056946.1
AGGTGCAAGAGCTGAAGCGAGTTGAGGAGGCTGAACTGAGAACAGGATGCAAGAAGCCCTGTTGTCTCTACACCACAAGACGCAGAATTTGTACATTATTTTTTCATTTAAAGACTTGGAACCTTCCTATATTGCAGTTGATGGAGGTGCTGAGGAGAGCTAAATGTGCCTCCTTTATTAGGCGCTATTGTGAGACCTCCACCCCAGAGTGGGAAGAGAGACGACGCCTGCACAAAACCCGGCTTCGAATCCAGTAACTTCGCGTTTCAGAACAATCACCAAACAAAAACAAGTTTGAGATACAATAAGACCCTGCCTGGTCTAATTGTCAATCGGTCTTTTCTAACTTTTCCCTCCCTTCTCCTTTTGGATGCTGTTTCCTCGTGCAGGATCTAAACCAAGGGCTATATTTACAGACCAGCCCGCGATTGCTGAAAAATTAGCATTTTAACGATATCAGTAGCTCTGGAAAGGAGAGAGAAGGGACTGTTGCCTGCCATTTGGTAATTGAAATTTGATGGGTAAACTAATTATGCCATTATTATTAACAAATAAATTACTTATTAATTCCACCT

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT056947.2
NONMMUT056950.2
NONMMUT056952.2
NONMMUT056953.2

Data Sources


Source NameOld Id
NONCODEv4NONMMUT056946
gencodeENSMUST00000139055.1
PMID26117828PNCT_MMU203496
PMID26117828TCONS_00010118
NONCODEv3n282102
PMID235831TCONS_00027102
ensemblENSMUST00000139055