An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056953.1

General info


NONCODE TRANSCRIPT IDNONMMUT056953.1
NONCODE Gene IDNONMMUG035351.2
Chromosomechr6
Start Site52208358
End Site52213456
Strand+
Exon Number3
CNCI Score-0.0684032
Length629
Assemblymm10
Other transcript VersionsNONMMUT056953.1(old version)

Sequence


>NONMMUT056953.1
GAGGCGCCACTGAGGTCTTTATCAGAATAGAAACATGAGGCCCCGTACTCGTAGGATGCCCGGTTGCAGGCCAAGACCGAGTTGGACTGTTGGTAAAAACAAGAATTCCACACACGCATCTAGCCCCTCTTCCAGGGCTCGAGAAATCACTCTAACCAGAAAACCGGGCAAACGAAGCAGGCAACCATCGGAGAACTCTGAATTAGTCTCACCTTCAGACCGCGGCTCCCAGAAGCTTCTGCCTCTCTGACAGCTGTCGCTTCGGCAGCCCAAGAGACGAATTGTCCTCCTTCCTGGTGCCAGAGGACGCAGGAAATTAGCCAGGTTGCAAGTTGCAAAGCAGCGGCGGCTGCTCCAGGAACTGGACGCGCTCCACCTCCAGCGACAACGGCTGGCCTGGGCCTGGCAGCGGCTTCCCCTCGCTCGCCATCGCCGGACAAAGCGCAGCCCAGGCAGGCTGGCAAGGCAGAGCTCCGAAGCACGCAGGATGGAGCGGAGCAAAAGAATGCGGCTCTATTCTCGCAAGGGAAATTATAAAAAAGTTCATGTTCACGGTTCCTATCCACATGACCGACAGCGGCCAATGGAAGGGCCGAACAACTCATAAAGTTGTATTGCAAAGTTGTAAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT056946.2
NONMMUT056947.2
NONMMUT056950.2
NONMMUT056952.2

Data Sources

Source NameOld Id
NONCODEv4NONMMUT056953
PMID235831TCONS_00027106
noncodeV3n412086
PMID26117828PNCT_MMU203502