An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056955.1

General info


NONCODE TRANSCRIPT IDNONMMUT056955.1
NONCODE Gene IDNONMMUG035352.2
Chromosomechr6
Start Site52217028
End Site52221854
Strand-
Exon Number2
CNCI Score-0.1572864
Length577
Assemblymm10
Other transcript VersionsNONMMUT056955.1(old version)

Sequence


>NONMMUT056955.1
CCAGAGCAGCTGCGGCTGCAGTGCCAAGAAAATTCCAGGAGATGGCAGTGTGGCTCCACGCAAGAGGCTTTCTCGCCGCCATCTCCGGCCGCCGAGACCTAGGAAGCTCCTAAAATGTCGACTTGAAGCGAGCCTTTCTGGAATGGGATTTGTGTGAGCAGCAGTCGTATATTTTCCCTGCTGCTCATGCCAGCCTGAAAGCCTCCAAGGGACACAGCATGCGCCGGGGCTTGCCTGACCTTCGGCGCTCGCTCCTCCCCGGCCCCATTCCGAGACCGCTGTGTTGCGTGGCAGCAGCGACGCCGAAGAGAAGCGGCTACGGGCCGGGCGCCGGCGCCTTCGCCTCCACTGTGCCGGGCTTATACAATGTCAACAGCCCCCTCTATCAGAGCCCCTTCGCGTCCGGCTATGGCCTGGGAGCCGACGCCTACAACCTGCCCTGCGCCTCCTACGACCAAAACATCCCCGGGCTCTGCAGTGACCTCGCCAAAGGCGCCTGCGACAAGGCGGACGAGGGCGTGCTTCACGGCCCGGCCGAAGCCAGTTTCCGCATCTACCCCTGGATGCGCAGTTCAGG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT056955
PMID26117828PNCT_MMU030289
ensemblENSMUST00000150041