An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056966.1

General info


NONCODE TRANSCRIPT IDNONMMUT056966.1
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52245242
End Site52249769
Strand+
Exon Number5
CNCI Score-0.0376832
Length1839
Assemblymm10
Other transcript VersionsNONMMUT056966.1(old version)

Sequence


>NONMMUT056966.1
GTCGGAGGAAGCGAGGTTTTCCGGGGTGCCGTAAGCCGTCTCGAAAAACTGGTCGAAAGCCTGTGGCAGAACGCCGTTCCTGCCCACCGTGCTATAGAAATTGGACGAGACGGCGGGGGTGGGGTGGTGGTAGACGTTGGCCGAGCTCTTGGCCAGCACGTCGCCAGGCACGCCGGCCGCGCTGGGCGCCTGCAGACAGTCTCTGTGCACGAGCTCCTCCGCGGAGTAGCAGTGGGCCAGATTGCCGCGGGGGTGCCATTTAGTGGCGGGCTCAATGGCGTACTCTCTGAAGGTCACTTCGCGCACGGGTTGGACCTGGGGCAGGTTGGAGGAGTAGGAGTATGTCATTGGGCGCGAAGACGGGGTCTGGGGCAAAAAAGAAGGGAGGCTGGAGAAATCTGGACCCGAGACGTAGTAAGTACAACTTGGCAAATACATGTTAGAGGAGCAGGGACCACGCTCATCAAAATCCATCATTGGGCTACCTTGGGCTCTCCGCAGTAGCCGAGCTTAACATGATTCTCCACTGCAGCTGCCTCTTTGAAGCGGATCCGTGAAGTAGAAATTTGGAGACCCACCTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCCGCGCGCAGAAAGGCTGGGGTGCGCCCCCGGGCAGCTCTCCTTTGCTCAGCTACATGGTCCTGGTCCACGAGTGCTCTGAGGGCGGCAAGAGAGCGCAACTCCTGACGCCTCCCCCCACTCCCCGCCCCCCTCCCACAGGTTTGCTCTGGGAAGCCCCCCAGCCTCAGACCCTGGCTGGACCCCATTTGGGGCCAGGCTTCGCCGGCACGGATGTGCCGGCCTCGTGGCTTGTCCGATTTGCACGGTGACTTGATTACACGCTCTCATTCACGGTCACTTCCGAAGCGCTTTAGTGCCTTCCGTCCCCAAACCGCCAACAGGCAAAGCGGCTTCCCTCCGCGGGGTTCGGAGTGACTCCTCAGAGCCAGAGGCACTTCTGCTCACCGGTCCGCAAGCTGCCTGGTCTGCTGAAGCTGACGAATCGGGAAACCATGCAATTGAGGCGAACCTTGGGCTGTTTTAGAGGCGCTGAGGAGCCTTCTCCTGGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT122276.1
NONMMUT056965.2
NONMMUT056967.2
NONMMUT056968.2
NONMMUT056969.2
NONMMUT056970.2
NONMMUT056971.2

Data Sources

Source NameOld Id
PMID235831TCONS_00027108
ensemblENSMUST00000134512
refseqNR_015348
NAMEHoxa11os
PMID26117828PNCT_MMU203509
gencodeENSMUST00000134512.4
PMID26117828TCONS_00010122
NONCODEv4NONMMUT056966
NONCODEv3n4889