An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056967.2

General info


NONCODE TRANSCRIPT IDNONMMUT056967.2
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52245968
End Site52249795
Strand+
Exon Number3
CNCI Score-0.0122880
Length1116
Assemblymm10
Other transcript VersionsNONMMUT056967.1(old version)

Sequence


>NONMMUT056967.2
CTTCCTTTCTTTGTAGCCACCTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCCGCGCGCAGAAAGGCTGGGGTGCGCCCCCGGGCAGCTCTCCTTTGCTCAGCTACATGGTCCTGGTCCACGAGTGCTCTGAGGGCGGCAAGAGAGCGCAACTCCTGACGCCTCCCCCCACTCCCCGGAACCCCTTCTCCTCGCTGCCTGTAGGGGTTCGGAGTGACTCCTCAGAGCCAGAGGCACTTCTGCTCACCGGTCCGCAAGCTGCCTGGTCTGCTGAAGCTGACGAATCGGGAAACCATGCAATTGAGGCGAACCTTGGGCTGTTTTAGAGGCGCTGAGGAGCCTTCTCCTGGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCCTCTGC

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
0001.21661e-278.75854e-104.59726e-75
Loading...


Isoforms


Transcript ID
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056968.2
NONMMUT056969.2
NONMMUT056970.2
NONMMUT056971.2
NONMMUT122276.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00010123
PMID235831TCONS_00027110
NONCODEv4NONMMUT056967
PMID26117828PNCT_MMU030295
gencodeENSMUST00000147174.2
ensemblENSMUST00000147174