An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056968.1

General info


NONCODE TRANSCRIPT IDNONMMUT056968.1
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52245988
End Site52249790
Strand+
Exon Number3
CNCI Score-0.0299008
Length1065
Assemblymm10
Other transcript VersionsNONMMUT056968.1(old version)

Sequence


>NONMMUT056968.1
CTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCCGCGCGCAGAAAGGCTGGGGTGCGCCCCCGGGCAGCTCTCCTTTGCTCAGCTACATGGTCCTGGTCCACGAGTGCTCTGAGGGCGGCAAGAGAGCGCAACTCCTGACGCCTCCCCCCACTCCCCGGGGTTCGGAGTGACTCCTCAGAGCCAGAGGCACTTCTGCTCACCGGTCCGCAAGCTGCCTGGTCTGCTGAAGCTGACGAATCGGGAAACCATGCAATTGAGGCGAACCTTGGGCTGTTTTAGAGGCGCTGAGGAGCCTTCTCCTGGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCC

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT122276.1
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056967.2
NONMMUT056969.2
NONMMUT056970.2
NONMMUT056971.2

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU203510
gencodeENSMUST00000141850.1
ensemblENSMUST00000141850
PMID235831TCONS_00027109
NONCODEv4NONMMUT056968
PMID26117828TCONS_00010124
NONCODEv3n4892