An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056968.1

General info


NONCODE TRANSCRIPT IDNONMMUT056968.1
NONCODE Gene IDNONMMUG035357.1
Chromosomechr6
Start Site52195987
End Site52199789
Strand+
Exon Number3
CNCI Score-0.0730976
Length1065
Assemblymm9
Other transcript VersionsNONMMUT056968.2

Sequence


>NONMMUT056968.1
CTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCCGCGCGCAGAAAGGCTGGGGTGCGCCCCCGGGCAGCTCTCCTTTGCTCAGCTACATGGTCCTGGTCCACGAGTGCTCTGAGGGCGGCAAGAGAGCGCAACTCCTGACGCCTCCCCCCACTCCCCGGGGTTCGGAGTGACTCCTCAGAGCCAGAGGCACTTCTGCTCACCGGTCCGCAAGCTGCCTGGTCTGCTGAAGCTGACGAATCGGGAAACCATGCAATTGAGGCGAACCTTGGGCTGTTTTAGAGGCGCTGAGGAGCCTTCTCCTGGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCC

Expression Profile


NA

Isoforms


Transcript ID
NONMMUT056965.1
NONMMUT056966.1
NONMMUT056967.1
NONMMUT056969.1
NONMMUT056970.1
NONMMUT056971.1

Data Sources


Source NameOld Id
PMID26117828PNCT_MMU203510
gencodeENSMUST00000141850.1
ensemblENSMUST00000141850
PMID235831TCONS_00027109
NONCODEv4NONMMUT056968
PMID26117828TCONS_00010124
NONCODEv3n4892