An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056969.2

General info


NONCODE TRANSCRIPT IDNONMMUT056969.2
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52246220
End Site52249380
Strand+
Exon Number2
CNCI Score-0.0278528
Length885
Assemblymm10
Other transcript VersionsNONMMUT056969.1(old version)

Sequence


>NONMMUT056969.2
GGGCTGGGGGTGGCCAGGTGAAAGCCCGGAATTGTATAGCTTCAGGTCCCGGAGTCTGTTATCCGAAGGCTTACGTTCAGCACCTTCTTCGCAGCCCCCCTCCCACAGGTTTGCTCTGGGAAGCCCCCCAGCCTCAGACCCTGGCTGGACCCCATTTGGGGCCAGGCTTCGCCGGCACGGATGTGCCGGCCTCGTGGCTTGTCCGATTTGCACGGTGACTTGATTACACGCTCTCATTCACGGTCACTTCCGAAGCGCTTTAGTGCCTTCCGTCCCCAAACCGCCAACAGGCAAAGCGGCTTCCCTCCGCGGTTTGTCAATAATCCGCGCTGTCCGGAAGGGCCTTCGTCTTACCCGGGTTCCACCTTCCCTGTATCTTTCTGCTTACTTCCTTACCCCACACCCTGTCCTTGAAGGAACCCCTTCTCCTCGCTGCCTGTAGGGGTTCGGAGTGACTCCTCAGAGCCAGAGGCACTTCTGCTCACCGGTCCGCAAGCTGCCTGGTCTGCTGAAGCTGACGAATCGGGAAACCATGCAATTGAGGCGAACCTTGGGCTGTTTTAGAGGCGCTGAGGAGCCTTCTCCTGGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGA

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
0000.02207910.066280.0275242
Loading...


Isoforms


Transcript ID
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056967.2
NONMMUT056968.2
NONMMUT056970.2
NONMMUT056971.2
NONMMUT122276.1

Data Sources


Source NameOld Id
NONCODEv3n412449
NONCODEv4NONMMUT056969
PMID235831TCONS_00027111
PMID26117828PNCT_MMU203511
gencodeENSMUST00000137729.1
ensemblENSMUST00000137729