An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056970.2

General info


NONCODE TRANSCRIPT IDNONMMUT056970.2
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52248421
End Site52249799
Strand+
Exon Number2
CNCI Score-0.0475136
Length829
Assemblymm10
Other transcript VersionsNONMMUT056970.1(old version)

Sequence


>NONMMUT056970.2
GAGGTGGCTCAGCCGCGGGGGACGCCAGGCCGCCTCCCCTGACTACATGGCAGCTTCTCTCATAATTAACTCGACTTCCCGGGATGCCAGGGAGAAGGGGTACCCACAGAAAGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCCTCTGCTGAA

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
0001.13186e-217.38465e-183.47194e-62
Loading...


Isoforms


Transcript ID
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056967.2
NONMMUT056968.2
NONMMUT056969.2
NONMMUT056971.2
NONMMUT122276.1

Data Sources


Source NameOld Id
NONCODEv4NONMMUT056970
PMID26117828TCONS_00010125
PMID235831TCONS_00027112
PMID26117828PNCT_MMU203512
NONCODEv3n413111
gencodeENSMUST00000154027.2
ensemblENSMUST00000154027