An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056971.1

General info


NONCODE TRANSCRIPT IDNONMMUT056971.1
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52248690
End Site52249798
Strand+
Exon Number1
CNCI Score-0.0081920
Length1108
Assemblymm10
Other transcript VersionsNONMMUT056971.1(old version)

Sequence


>NONMMUT056971.1
ACAGAGGCTGACAGAGCAATTCGACAGGCTCTACAGAAGAGGGGTGCCCAGAGGGGCATCCTCGAAGGGAGCGTGTGGGGGCGCTGCGATGAAGATGGATGAGGGAAAGGCTTTTGATGGGGGTGGGGGGGAGGCGGATGGCCTGGAGATGCCGATTGCGTTTAGTTCTCTTAAGCAGAGAGAAGAAATGGATGCTCAGATCCCTAAGGCTGCTCAATAGTAGCCGCTTTGCCTGCTTGGCCCTGGTAGTGTGAATGTTCTTCAGTCATGCATCAGGGTACAAGGTGCGAGCAGCCCTGAGGTTCGGACCAAATCTGGAGGAAGAAAGGGAGGTCTCTGAGGGTCCTTGGTTTTCACTTTGCTTTGAGCTTAACTGGTTCTTTGGCTTTCCAGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCCTCTGCTGA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT122276.1
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056967.2
NONMMUT056968.2
NONMMUT056969.2
NONMMUT056970.2

Data Sources

Source NameOld Id
PMID23583100Hoxa
NONCODEv4NONMMUT056971
NONCODEv3n4891