An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT056971.2

General info


NONCODE TRANSCRIPT IDNONMMUT056971.2
NONCODE Gene IDNONMMUG035357.2
Chromosomechr6
Start Site52248690
End Site52249798
Strand+
Exon Number1
CNCI Score-0.0081920
Length1108
Assemblymm10
Other transcript VersionsNONMMUT056971.1(old version)

Sequence


>NONMMUT056971.2
ACAGAGGCTGACAGAGCAATTCGACAGGCTCTACAGAAGAGGGGTGCCCAGAGGGGCATCCTCGAAGGGAGCGTGTGGGGGCGCTGCGATGAAGATGGATGAGGGAAAGGCTTTTGATGGGGGTGGGGGGGAGGCGGATGGCCTGGAGATGCCGATTGCGTTTAGTTCTCTTAAGCAGAGAGAAGAAATGGATGCTCAGATCCCTAAGGCTGCTCAATAGTAGCCGCTTTGCCTGCTTGGCCCTGGTAGTGTGAATGTTCTTCAGTCATGCATCAGGGTACAAGGTGCGAGCAGCCCTGAGGTTCGGACCAAATCTGGAGGAAGAAAGGGAGGTCTCTGAGGGTCCTTGGTTTTCACTTTGCTTTGAGCTTAACTGGTTCTTTGGCTTTCCAGGAGGCCCAAGGTTGATTTCAGCCCACCAGGATCTGGGGAAGACCCAACTAGGGATAAGAGCACACCAAAAGGCCAAGTCCGAGTTCCATTTCTAGAAGAGGCGGCTTCCGGCAAGGCTATGACATTGGCCCTGGACATTGGTTTCCCAGGAGCTGCTTTTTCTCAAGAACTCCACAGCACGGGGCTGTCTCCAGAAAACGCTCTTCAACGTTTATTTCTTTTAATCGTCGCCCGGAGCCCTAAGGCGGCTAATGCAAGAGGCCAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCCGCGGCCTGACGGTGCGTGTGTGTCTGTAAAGAAGGGAGGGAGCCGGTTCAACCTCCCCTCGTTTTCCCGAACTTCAAGGTCTAGGCAGACCCCCTTAGGGCCTTGCCGAGGCTCGCCCCCACACCCCCAGCGGCGCAGCATTTGGAGGTGGCCAACGATTTAAGCCTCGGTCGGGCTGAAAGGAGATTTGATCGGCAGAACAAACCAACCCTTTTCGGAGGTTTCTTTTGATTTGGTCCTAAAGGGTATATGCTAGTGTCCACAGCGGCTGGGGTGGCTGCTGTTTTCCTCCCGCCGGGCTAAAAGTACCAAGAAGGGAGGGAGGGAGAGAGATTCAGGCACCTTGCGCTGGCTGCACTCTCCTTCTGAGATAGAATACCAGAATAAAGTGTATTCAGGTGCCTCTGCTGA

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
0001.66041e-270.06398250.00712275
Loading...


Isoforms


Transcript ID
NONMMUT056965.2
NONMMUT056966.2
NONMMUT056967.2
NONMMUT056968.2
NONMMUT056969.2
NONMMUT056970.2
NONMMUT122276.1

Data Sources


Source NameOld Id
PMID23583100Hoxa
NONCODEv4NONMMUT056971
NONCODEv3n4891