An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT057062.1

General info


NONCODE TRANSCRIPT IDNONMMUT057062.1
NONCODE Gene IDNONMMUG035412.2
Chromosomechr6
Start Site54588539
End Site54589426
Strand+
Exon Number2
CNCI Score-0.0491520
Length326
Assemblymm10
Other transcript VersionsNONMMUT057062.1(old version)

Sequence


>NONMMUT057062.1
GAGGGTCACACAGCAGGGAGGGTCACACAGCAGGGAGGGTCACACAGCAGGGAGGGTCACACAGCAGTGAGGGTCACACAGCAGTGAGGGTCACACAGCAGTGAGGGTCACACAGCAGGGAGGGTCACACAGCAGGGAGGATCACACAGCAGGGAGGGTCACACAGGGTTACCTTTTCCTTCTTTGCCATAGCCCAGGGCAGGAGGAACGGTGAGCTTTCGCTTCTCTCCCACACACATTCCCTTCAAGCCTTGGTCCCAGCCTTTGAGAACCTCCAGTATGCCCAGGGTGAACCAGACAGGCTGACCATTGTTATGTTTGTGACT

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT057060.2
NONMMUT057061.2

Data Sources

Source NameOld Id
NONCODEv4NONMMUT057062
PMID26117828TCONS_00010408
PMID26117828PNCT_MMU030340