An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT059121.1

General info


NONCODE TRANSCRIPT IDNONMMUT059121.1
NONCODE Gene IDNONMMUG036731.2
Chromosomechr6
Start Site130567638
End Site130568801
Strand+
Exon Number1
CNCI Score-0.0573440
Length1163
Assemblymm10
Other transcript VersionsNONMMUT059121.1(old version)

Sequence


>NONMMUT059121.1
TTCTGAGGCCTCTACATAAGTCCCTACTCTGGACCAAAATTTAACAGTCCCATCTGAGGAAAGATTGTGTTAAACAGAAGATGTTTGATAAGGAAAACTCCATTCATGAAAGACAAGAGCCCTATGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGGCAGTTTTCTGTGTGCAATTGGCAGCAAGAAGTCCACCAAGAGATTTGGAAGAATTGTTCTCTACAGTAGAAAAGGTTCGAGATGTGAGGATGATTTCTGATAGAAATTCAAGATGGTCAAAGGAATTGCCTATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTACCAAATAGATTAACTGGCCAATGAGTTTTAGGAGTGACAATCACAGTCCAGACATCACAGCCAGAAAAAGACATAGCTGCTGCAATGGTAAACAATTTTAAAAAAGGACCTATGAGGCTCTACTTGGGCTCATTAAACTTTAACATAACTGAAGAAATGATTTAGGAAGATCTTTGAACCTATTGGAAGGATTGAAATTATTCAGCTGCTGATGGATAATGAAACTAGTTGATCTAAGGGATATGGATTTGTTGCATTTTCTGACTAAGAATGTGCCCAAAAGGCTTTGGAACCGTTTGATGGTTCGAGTTAGCTGAGAGACCACTGAAAGTTGGTCCTATTTTTGGAAAAACTGATGCTTCTAGTGCTAGTTCATTTTTGGACAGTGATGAACTACAAAGGACTGGAGTTGACTTGGGAACAACTAGCCATCTTCAGGTACTGGCAAGACTTGCAGAGGGTGCCTGATTGCAGATTCAACCTGCAGCACAAGTTTTACAAATGAGTGGCTCTTTGGCATTTGGTGCTGTTAGATTTGCAACACCACTTTCAAGACAGACCAAAGCCTCAGATTTTGCTGCAGCTCTCTGTTCAACCACTTGCAACAGTGTTTTCCACTTTCTAACATGTTTAATCCTCTAGAACAGAAGAAGAAGCTGGATGGAATACAGAGGCTAATGCCATTGGAGAGTGTAATAAACACAGAGGAGTCATATTTATGTTTACAAAAATTCAGCCTAGGGCAATGTTTATGTGAAGTGCCCATCTATTGCTGTGGCTATTACTCCTGTCCATGCATTGCATGGCAGGTTGTTTGTGATAAAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT059121
ensemblENSMUST00000182280