An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT064161.1

General info


NONCODE TRANSCRIPT IDNONMMUT064161.1
NONCODE Gene IDNONMMUG039608.2
Chromosomechr7
Start Site140897568
End Site140898692
Strand+
Exon Number1
CNCI Score-0.1134592
Length1124
Assemblymm10
Other transcript VersionsNONMMUT064161.1(old version)

Sequence


>NONMMUT064161.1
ACTGTGCTCCCAGCGTGTCTCATGAAGCCCCCTGCACAGGTGGAGTTGCTGGTGATGAAGGCACTCTCGGTGGGGCTGGTGAGAGGCAGCATAGACGAGGTGGACAAGCGGGTTCACATGACGTGGGTGCAGCCGCGAGTGCTGGATTTGCAGCAGGTAAGGGGGCTGGGCCCCTGCCCTTTGCGGGTTTACCAATGCTGTCCTAGTTTTATGTGGACAGAAGCCATTTAGGAAGCGGACGCTGTCGCACACAAGGTGGGATTACTGCTGTGGAGGCCTAGCAAAGCAGCCCTCTGAGGTCTGCGCCCTGCACTTCCAGGCTGGCTGCGCTGCTGATGCCTCCTAATCCTGAAATTGCTGCTCCAGCAGACGTGTTCCTGGTTTTGTGACTTGATCCCATGCCCTATCATGTTTCCCGGACATTTAATCCTGTGCTTTCCTCATTCTTTTTTCTTTCATGGGAGATTTTAGAATGTCCTCGTGATCAGATTTGGCACAGTGACTCCATTACACACCTCCACCTTCAGCTCCATTGCCCTTAGCTTTTCCCAGAAAAGAACTAGAGGCTCAGCCCTCCCAGACTCCCTTGCAGCTGATACCCATGTGATCCCGATTTGCCTTTAGATCAAGGGGATGAAGGACCGTCTGGAGCTTTGGTGCACTGATGTGAAGAGCATGGAGATGCTGGTGGAACACCAGGCTCAGGACATCCTCACCTAGTGCCCCGGTGTCCTGCAGACCCTGCCGCACCTTGCAAGGCAATTCTGTGGCCCCCGAAACCATCAGCAGAGATCTGTATTCACTTGGGATGGAGTTTAGGATCCTGCTCGGAGTGGGAACTGTTCTTGCTATAAAAGCAGAGAACTGTCGCTGGTGGGGGGGTGACTACTTGGAGAAGGCTCCTGTGTGGGGTCTTTTGTAGCCTGCAAGGGGTGGGAAGGGGGGCTCCAGGCCTAGGTGATGAGAAAGGGCACGAATGGGAATGGGGACAGGGTAGTCTCCACCCAGCTCCACCTGAGTGGACTTTGTCCAGTGTGGTCTGAGTGCTGCTCTAATAAATGCCTTGGCATTGTTCTCTTGGTGCTTCTGTTCTTTGCCTTAGCTCCTTAGCCAATCCTGTGTCT

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n290672
NONCODEv4NONMMUT064161