An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT064279.2

General info


NONCODE TRANSCRIPT IDNONMMUT064279.2
NONCODE Gene IDNONMMUG039673.2
Chromosomechr7
Start Site142575633
End Site142576538
Strand-
Exon Number2
CNCI Score-0.0311296
Length817
Assemblymm10
Other transcript VersionsNONMMUT064279.1(old version)

Sequence


>NONMMUT064279.2
CTTTGCAGAACACCATGGGCTGGCGCCTTGTCGTAGAAGCCGTCTGTTCTTTCACTTTTCCCAAAGAGCTAACACTTCTCTGCTGCTCTCTGGATCCTCCTCCCCCTACCTTGAACCCTCAAGATGAAAGGTGAGTTCTCTTCTGCCCCATGTGGGTGGGAGAGGGTGGGATGCCAAGGACAGGGGTCTCATTCTCTCCCACCCATAGAAATGGTGCTACCCAGCTCATGTCTGGGCCTTTGAATCCGGGGACTTCTTTAAGTCCGTCTCGTTCTGAATCAAGAAGATGCTGCAATCAGAACCACTACACTACCTGCCTCAGGAATCTGCTCCAAGGTGAAGCTGAAAGAACAGATGGTGTCAACATTTTGAAAGAGCAGACTCATAGCACCCACCCACCCCTGAGAATCCATCTTCATGGCCAACTCTGCCTGACCCGGGAGACCACCACCCACATCATCCTGGAGCCAAGCCTCTACCCCGGGATGACTTCATCATCTCCCTCCTGTCTTTTTCTTCTTCCTCCTTTCCTGTAATTCTGTTTCTTTCCTTTTGTTCCTTCCTTGCTTGAGAGACTCAAAGCACCCGTGACTCTGTTTCCCCATTTACCCCCTTTTGAATTTGCACTAAGTCGATTGCACTGGTTTGGAGTCCCGGAGATAGCTTTGAGTCTCTCCGTATGAATGTATACAGCGAGTGTGTAAACCTCTTTGGCAATGCTGCCCCAGTACCCACCTGTCGTCCATCTCCGTCTGAGGGCAACTGGGTGTGGCCGTGTGCTTGAGGCCTCGCCTTCCCCTCGCCTAGTCTGGAAGCA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
0.002884450.2712710.46349200.9237860
Loading...

Isoforms

Transcript ID
NONMMUT127917.1
NONMMUT127918.1
NONMMUT064276.2
NONMMUT064277.2
NONMMUT064278.2
NONMMUT064280.2
NONMMUT064281.2

Data Sources

Source NameOld Id
PMID235831TCONS_00029595
NONCODEv4NONMMUT064279
gencodeENSMUST00000140716.1
ensemblENSMUST00000140716
PMID26117828PNCT_MMU034367
PMID26117828TCONS_00011005