An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT064280.2

General info


NONCODE TRANSCRIPT IDNONMMUT064280.2
NONCODE Gene IDNONMMUG039673.2
Chromosomechr7
Start Site142576422
End Site142576800
Strand-
Exon Number2
CNCI Score-0.0696320
Length296
Assemblymm10
Other transcript VersionsNONMMUT064280.1(old version)

Sequence


>NONMMUT064280.2
CAGTCTCCTCCCACGCAAGTTCAATTAACTCATGTCTTCATTTCTCCCTATAGCCAGGTCTCCAGCAGAGGTGGATGTGCCTGCCAGTCACTGAAGGCGAGGATGACAGGTGTGGTCAATGTGACAGAAAGACATGACATGGTCCGGTGTGATGGAGAGGACAGAAGGGCAGTCATCCAGCCTTCTTGAACACCATGGGCTGGCGCCTTGTCGTAGAAGCCGTCTGTTCTTTCACTTTTCCCAAAGAGCTAACACTTCTCTGCTGCTCTCTGGATCCTCCTCCCCCTACCTTGAAC

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT127917.1
NONMMUT127918.1
NONMMUT064276.2
NONMMUT064277.2
NONMMUT064278.2
NONMMUT064279.2
NONMMUT064281.2

Data Sources

Source NameOld Id
NONCODEv4NONMMUT064280
PMID26117828TCONS_00011583
PMID26117828PNCT_MMU034368