An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT064281.2

General info


NONCODE TRANSCRIPT IDNONMMUT064281.2
NONCODE Gene IDNONMMUG039673.2
Chromosomechr7
Start Site142576506
End Site142578095
Strand-
Exon Number4
CNCI Score-0.0663552
Length935
Assemblymm10
Other transcript VersionsNONMMUT064281.1(old version)

Sequence


>NONMMUT064281.2
TGGGGAAGATGGGAGAGCTGGAGGAGAGTCGTGGGGTCCGAGGAGCACCTCGGCATCTGGAGTCTGGCAGGAATGTTGAAGGACTGAGGGGCTAGCTCAGGCAGAGCAAAGGCATCGCAAAGGCTGGAAAACATCGGAGTGAAGCTGAAGGGCCTGAGCTAGGGTTGGAGAGGAATGGGGAGCCAGACATTCATCCCGGTTACTTTTGGTTACAGGACGTGGCGGCTGGTCGGATAAAGGGGAGCTGCTGGGAAGGGTTCGACCCCAGACCTGGGCAGTGAAGGTATAGCTGGCAGCAGTGGGCAGGTGAGGACCGCCGTCTGCTGGGCAGGTGAGTCTCCTTCTTCTCTCTTGGCCTCGCTCCACTGACCTTCTAAACGAAGGTTTAGAGAGGGGGCCTGGTGAGAAGAAGCGGCTGGCCTCGCAGCAGAATGGCACATAGAAAGGCAGGATAGTTAGCAAAGGAGACATCGTCTCGGGGGGAGCCGAGACAGAAGGAGGCTGGGGGACCATTGGCGACCCCAGGTGGAAAGAGCTCTTAGAGAGAAGAAAGAAGAGGTGCAGGGTTGCCAGTAAAGACTGAGGCCGCTGCCTCCAGGGAGGTGATAGGAGTCCTTGGAGACAGTGGCAGAGACCATGGGATCCAGCAAGAACAGAAGCATTCTAGGCTGGGGTCAAACAGGGCACTGGCCTCCAGAGTCCGTGGCCAAGGAGGGCCTTGCGGGCGGCGACGGAGCAGTGATCGGTGTCTCGAAGAGCTCGGACTGGAGACTAGGCCAGGTCTCCAGCAGAGGTGGATGTGCCTGCCAGTCACTGAAGGCGAGGATGACAGGTGTGGTCAATGTGACAGAAAGACATGACATGGTCCGGTGTGATGGAGAGGACAGAAGGGCAGTCATCCAGCCTTCTTGAACACCATGGGCTGGCGCCTTGTC

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT127917.1
NONMMUT127918.1
NONMMUT064276.2
NONMMUT064277.2
NONMMUT064278.2
NONMMUT064279.2
NONMMUT064280.2

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU034369
ensemblENSMUST00000149974
PMID26117828TCONS_00011006
PMID235831TCONS_00029596
NONCODEv4NONMMUT064281
gencodeENSMUST00000149974.1