An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT065198.2

General info


NONCODE TRANSCRIPT IDNONMMUT065198.2
NONCODE Gene IDNONMMUG040297.2
Chromosomechr8
Start Site34589419
End Site34640316
Strand-
Exon Number5
CNCI Score-0.0458752
Length2121
Assemblymm10
Other transcript VersionsNONMMUT065198.1(old version)

Sequence


>NONMMUT065198.2
ATTTTCACCCGAAGCTCTCTGTAAAGCCAGAGCCTGTGCCTATTGCCGTCATCATTCTCTGAAGAGCTCAGACACAAGTACCAGCTGTGTAGCTCAAGCCCTTGCTGGAGAGGTGGTAATGGGTCTATTCTTAGCGATCATACTGTGATGGTTTCTCTGCCTTGCGGGACTCCTGTCATCGCATCCAGAAAAGAGCAGTGAGGCGCTTCCTGGGAGCCGAATATTGTGGCTAGAGAGGCAGCCCTTGCCTTCCAGGCACTTCCATCCGGGAGGAAGAATGCAGATATACTGGTCATCGTGTATTCAGTTCCATACAAGGAGAAATTAAAATCACGGCATGGTGGCTGGTTTTCCTTTTCTCATTCTTCACAGACAGTGGGAGGATATGACTCTGGAAAATTAACATCAAGTGCTTGTGAGGAAGACGGGCCTTCCCACGAAGAGCTGAATACCCACCCCATGCCTGCAGTTGGGGATGTTTTATCATTGGGTCACAACTACCAGCGTGTGAGGCGCGGATGATATGGAATCACTTCAAGTTTTGTATTAGGAACAAAACAAAGCAACACAACCCTTGAAGCTGGCCTGTCCCCAGGGATACATATTCTTCAAAGAAATCCCCAATACCAACCACTGTAGCAAGAAGTCTATGTTACATGGATGGGTACTATGTCTGTCCAAGGGGATTCATTGCTAGAGAATCAGCAAACATTCAGTTAACAGTAACCATGCTGCTGCTACTTCTAATAAGATCCCATGTGTTTCTCCCTGCCCCCAGCCCTGGAGTGTGTAGATTTTTCCTAGCATTGCAGAATTTGACTCAATGCTGTTCAATTATTTGCCCTGTTGAAGAAAATCCCTGGTCCCTCCATTTCAAAGTACAAATTTTGTTCCATGAAGAAGCCTAGCAAATACAAGACTGGAGAGCTGCCACACCGCTCAACCTTCTATCTTGGACAGAGGTGGTACCTCACCCTCTCTCCCTTCCTTCCAAGAGACTGGGTCCTTCAGTCTAGTGTTGGCCCTCAGTTCCTCCTTCACAGACGCTGCAATGAACTTGATTTAGTAAGTTACCTGGGCATCCTTTTGTTCTCCTGCAGCTGATCATTTCCTCCAACTCTACCATTCTTTTTTCAATCTTTTCTTCTACGTTCTGCTGCCATTGGCTGCTTTCGGTCCTTCACAGCATCCTCTGCAGTCTCCAGGTTGTCTATTGCATCTGGTATTCATCTTGTCCAAATGTCCCTGATTTGTGCCACCAGGAGGAGGTGATGGATTGAATCCCAAGACCCGCTGCAGCTCCTCCTTAGGGGTTTTCACATGGATAAACATGTGGTCCATGCTTTACGAACTCCTTCCTCCTCCCTTGTCACATGACTGGCCTACATTTCCCCATCCGCTGTGTATTGAGCTGGAGCAGATAACTCGAGTTCTGTGCTGAAGGATGTTCAGAAAATGACTAGTCCCTAAGGAACACCAGCTACAGGCAGACAACAGCAAAGCTGAGTTGAGCTGTCAGCATTGGAGATAAAAGTTTTGGATTCTTGAGGAGGGAAGTTGCCCACCGTGAAGTCAAACTTCTGCCTACATCAGGAGGAGATGCACATGTATATGGAAGTATTTGGCTCTATTTATAACTTTAAAAAATATCCCAGATCAAAGCCTGTATTCCATTTGGTCTCTAAGCCCTTTCATAAGTACCTCTTTCCTACTTGGCGCTACCTCGGTTCTCCTGACCTCTCTGTTAGCCCCGAGCATGCCCATTCCTGCCTTCCTGCTCATGCCTGCTGCTTCTCCTGCCCTCTGCCTTCGTTTCCTTTGCTCATCTCGATTTGCAGCTTTTCCAGGAAGACCTCTAGACACTTTTACTCCGCGCTCCTCTCTCTAGCTCAGCAACAGACTGGGTCACTCTTGAGTTGGTTTGAGCTAGTCCTTTCTGGCCTCTAAGGCAAGAAGAGTCCCCTGGGCACAGGTCCTCTGTTCTGGGTATAAAATACAGGCTGAGGATGTGTGGGTAGGTTGCCATCTCAAGCATGCGGACTCTGTTCCTCGGAATGAATCACGTGTGGTGTGTTCTCCAGTAGACAATTTGCTTGTTCAATAAAAGGCTCACTGGGTGTC

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
0000.046514800
Loading...

Isoforms

Transcript ID
NONMMUT130480.1
NONMMUT130481.1
NONMMUT130482.1
NONMMUT130483.1
NONMMUT130484.1
NONMMUT130485.1
NONMMUT065196.2
NONMMUT065197.2

Data Sources

Source NameOld Id
NONCODEv3n276587
NONCODEv4NONMMUT065198
PMID23951020KnowTID_00007214
refseqNR_040706
NAMEB930018H19Rik
PMID26117828PNCT_MMU227767