An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT066295.1

General info


NONCODE TRANSCRIPT IDNONMMUT066295.1
NONCODE Gene IDNONMMUG041031.2
Chromosomechr8
Start Site81197626
End Site81198214
Strand-
Exon Number1
CNCI Score-0.0065536
Length588
Assemblymm10
Other transcript VersionsNONMMUT066295.1(old version)

Sequence


>NONMMUT066295.1
ATGAACAGAACCCTTCCACCATGTGCCTCAGTTTTGCCTAAAGAGATCTGTGCAAGAACCTTCTTCAGAATCACTGCGCCATTAGTAAATAATCGAAAGGACTATTCAGAGAGAAGAATTGTAGGGTACTCAATGCAAGAAATGCATGACGTAGTATCAGGAATGGAGGACTATCAGCATTTCGTTCCTTGGTGTAAAAAGTCAGATATAATATCAAGGCGATCTGGATACTGTAAAACCAGATTAGAAGTTGGGTTCCCCCCTGTTCTGGAGAGATACACATCAATAGTAACCTTGGTAAAACCACATTTGGTAAAGGCATCTTGTACTGACGGGAAACTTTTCAATCATTTGGAGACTATTTGGCGTTTTAGCCCAGGTCTTCCTGGCTATCCAAAAACTTGTACCTTGGATTTTTCAATTTCTTTTGAATTCTGCTCCCTTCTGCACTCTCAGCTCGCTACACTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGCAGCTTTTGAAAGAAGAGCATGTAAAATGTATGGTCCAGAGACAAACATCCCTCGGGAATTAATGCTTCATGAAATTCACCACACCTAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENSMUST00000178708
NONCODEv4NONMMUT066295