An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT079011.1

General info


NONCODE TRANSCRIPT IDNONMMUT079011.1
NONCODE Gene IDNONMMUG049149.1
Chromosomechr1
Start Site153690390
End Site153692656
Strand-
Exon Number2
CNCI Score-0.1392640
Length714
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT079011.1
AATCAACGGCAGCATCTCACTCTTTAGGTTTACTACTGCTTCTCAAACTGCTTTCCTGGGCTTTATTCCTCAGGATTCTAGATGAAATGTTGTGGAGGCTGAAGTCCAGATAGGCTTAGTTTCGTGATGTAAGTAAGGCCAGCCAGAACTCCAGGTTCTCCTCGCTGAACTCCGTCTTCAAGAAGGCACGGAAGGCTGCCACCCCATCTGTGGATGCAGAAAGAAACGGGAGAAAAGACAGACAGGAAGAAGCTTAAGATCAAAGATTGCAGATGAAGGAGACACAATACCAATTTGTCAGCATCCTGACTAGTCAAGCCTGTTGCTCCTCCACACCTAATGACACACAACTACTCTAGGAGCAAGCCATGTTTCTTGTCCATGGGCCAGCATGCAGGGAGAAATGTTTATATCCCATAGTGACAATAGTGGTCAGTTCTGATTAAACCCTCAGAGTTTACTGCCTTTCCACTAATGCCGAGTTGGCTAAACCCCCGAGTCTGCGGGTAAACCAAGGTAATAGGCACTATACTTCTATACCCTAAGCTGAGTCCACACCAGAGAGAAGACTCAGGCAGTCGTAAGACAAACTGGATGGGAATGTCTCAGGGCCAAGCCTTTACCACTATCAGAGAAATATCCAACAGAAATCCAGTCTGTACTACACCCTGCTGCATGGATAGTGTTCTCTGTCTCTTTTAGAAAACCTTTGAA

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
00000.06350160
Loading...


Data Sources


Source NameOld Id
ensemblENSMUST00000187154
gencodeENSMUST00000187154.1