An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT082028.1

General info


NONCODE TRANSCRIPT IDNONMMUT082028.1
NONCODE Gene IDNONMMUG051066.1
Chromosomechr10
Start Site61830866
End Site61831632
Strand-
Exon Number1
CNCI Score-0.0245760
Length766
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT082028.1
TGCCGCTCCGATCTTCATGTGGCAGCTTCCTTCTTCCCCCTTTTTCGGGGGATCCATTTGCCCAGTAAGGAACAGTGGCCCTTTTTCCACGACTAGGGCTACTGAAACCGCATGGATCCGACTTAGATTCCTTTTGGGGGTCAAGGGCACATGCGTGCAACTGGGCGTGGCAAAGGTTCCACGTAGTGGATCTAGACATGACATGGGGCTTAGTGGGTATGCTAGGATTGCCAAGGCCAGAATACCGGCTATCCAGCCCTCCCGCCATTCCCAGGGCATGTGAGAAGTGAATGCCTCCAATATCATTTGCAAATGGGCTTGAGGGTTATGGATGGCTTGCGGGATCCTAGACATTTGTACATAGTTGGATAGTCTCCACCACCTGCCATCAGACCTGGCTCAGCATCAGCACCAGTGGAAGAAGATAAACATCGTCTTGATCACCTTTTCTGCTGGGTCCCACGGCTCCCTGTGAAAAAGACTGTGAAACCATTTTAAAGGAGACATTTTACTTGCATTCCATTCATTCCAAAGACTGTTTTTGCGGAGGCAAAACAGTTTGCGTTTGCCAAAGTAAGCGTCCCGAAACTCCTCCAGCCAATGAGAATGTGCCCCCGCCCTAAGGTGTAGCCAATGAGAATTGCGCCTCGTAAGATACAGCCAATGAAAATGTGTTTCCCAAACACCCCCCCCACACACACACACACACACTCCTGATGTCTCTGTATTTGCCCTGGCCACAGCTTGCTATCTAGGGGACACTGGC

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
00.0143152000.05583790
Loading...


Data Sources


Source NameOld Id
PMID24038472CUFF.102070.1