An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT085708.1

General info


NONCODE TRANSCRIPT IDNONMMUT085708.1
NONCODE Gene IDNONMMUG053367.1
Chromosomechr11
Start Site96280105
End Site96280358
Strand-
Exon Number2
CNCI Score-0.0004096
Length214
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT085708.1
GTTGTTGCTGAAGTGAACATTTTTATCAAGTGCGGGGGATTTTATGGTCATGATTTGAGGACTCACTGGTGGGATAGAAATTCAATGGCTTGTTCTAAATCATCCCTACACCGTGCCAGAAATTTCTGATGGAAGGAAAATGTTTCTATTATGTTATAAACACCCAACGGAGGGCAGATTTATTGGAGAAACTCAAGTTGAGAAGACACTCCGC

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnHuman.ENSG000002483