An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT085709.1

General info


NONCODE TRANSCRIPT IDNONMMUT085709.1
NONCODE Gene IDNONMMUG053368.1
Chromosomechr11
Start Site96286769
End Site96287132
Strand-
Exon Number2
CNCI Score-0.0839680
Length305
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT085709.1
TTTACCTGAGCTTCGCATCCAGGGGTAGATCCGGAAGTTACTCTCGGCCGCCAAGTCCGAGTCCCTCTGCTCCTTGGCGCCAGCCGCCTTGGCGGGGTCGCCCGGACACACCCCGGAGAGGTTCTGCTCAAAGGGCGCGCAGTGCATGTTGAAGGAACTCGGTTCGAGCCCGTAGCCGGCCGCATAGACGCCAGCCGCGCTCTGGCCCGCCATGCTCCATAGCCCGGGCGCTGGGGGTTGGAAGCAAAGGCGCAAGAAGTTTGTTCGGGGAAGGCTCCTGGAGCGAAAACCGAACTTGCGGCTGG

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnOpossum.LocusForwar