An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT085710.1

General info


NONCODE TRANSCRIPT IDNONMMUT085710.1
NONCODE Gene IDNONMMUG007410.2
Chromosomechr11
Start Site96290032
End Site96308928
Strand-
Exon Number9
CNCI Score-0.0425984
Length1404
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT085710.1
CAGAGTTTGTTAAACTGACATGCAAAGTGTAGGAGGGGGGGTGCATCTTTTCAGAGACAAGCCTGGTTATCTGGGGCTCAGGACCCTGAAAGGATCTGGAAAGCAAGATAGACTGAGGCCAGGAGCCAGGAAAAAAAACGATTCCCATGGAACCCCCAGAAGCCAAACCTCCAAAGCGTATTCATATTTTAAGTGTTGCTGGCATCCTTTGATCCTTTGGGAGTGGAAAAGAGTGTCCTTTACAAGGGGTGTAAATGTCCATCGTTCTTTGAGAGATGCATCTTTAAGCTAGAATGTCATAGCGACTTTTGGGGTAGTTTGCTTTCGGCAAAGGGGGACAAAGTCATGGGGTGAGAGGGAAGGAGGACCCAAAACAGCCTCCAAGACCCTCACCATCTCTTCACCGGCTCCCCCTCCCCCCCCACAGGTCCTGTAAGAAGTTGGGCCCAGCTGGAAGGGATTGACCTCTTTCTTCCACTTCATGCGACGGTTCTGGAACCAGATTTTGATCTGACGCTCGGACAGGCAAAGCGCGTGGGCGATCTCGATACGTCGCCGCCGGGTCAGGTTGCTTGTCTGAAGATGGAGCCACAACGGCCAGGGCCAGGGCGCCTGGAGTCGGGCATGAAAGGAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGACGCCTCTTCGCCCTAGGCTGGCCTCTGCGGAGATTCCAGGCCCCACAGAGACCAGGACTTCCCTCAGCGCCACCGCCCCTCGTGCCAATGCAGCCGGGAAATCGCCATTACCCACACTGGGCAAGAGAAACCGCACGGGGGCAATCGGAGAGGCCAGGAAAAGGGAGAGATGGAGGGAGAACTTGGGGGATTTTGCCCTCCTCCGGATTCAAAAGGATGTGGAGGGAGGGATAAAGGAGCGTTCGGTATCTTCTTCAGCTTCCAGATAATATTGTCCCAACCTGAGAGCCGTCGTTTCCCCTTCTCAGACTTGAGAGAGAGGTTGTTTCGCTTTTCTGATATTTGCATAGAAAATGGAGTAAGTTCTGGCTTTGAAAAATGATATCAGGCTGCAGTCCGAAGGTTCCAGGTTGGCCGTACTCAGGAGCAGGCCGAACGGCCCAGAGGAAGCCCTGGCGTCCGGTGCTGCCAGGCTCACTGCGGACGCACCCCAGCCCGGTAAACTCACTGTCGCTCGCCGGGACTGGTTTCCCTTCAATTTAAAAATTTCATGTGGATCGCCCATGCCAATTTAGAATGAAATAGATTTAAATACATAAAGTAAAAATAAATTGAAATAAAAGCAAGGCATCTGATGAAAGATATACAGAAAGAGGCTCGTGAATAGGACCTAGAAACAGCAGCCAAAATGCACCAGACGCAGAAGCTAGTGGATCCTCAGGGCTCCATACAACCC

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT011703.2

Data Sources

Source NameOld Id
PMID24463510ENSMUSG00000085645