An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT089975.1

General info


NONCODE TRANSCRIPT IDNONMMUT089975.1
NONCODE Gene IDNONMMUG056025.1
Chromosomechr13
Start Site58397724
End Site58398069
Strand+
Exon Number1
CNCI Score-0.0286720
Length345
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT089975.1
CAGTGAGGCATAAACTGTTGGGACATACCGCTCGGGGCCACTGCTGTCTGGGACTGAAACACTGGCATTGTACTGCATTGGTCATTGGCGTTCGTGGATGTTGGCATTGGGCATGGGCATTCAATCAGAAGTTGTCAAGTATTGTACCCGTTTGGCAACGAGCACATTTTTGGGCATAGCCAACCAGGGTTTTCACATGGGCGTTCAGGGGCGGATGGGCCAACGTCATGGTGGGCAACGCAGGGGTAAGTCGATCCAGTACATGGGCAACGGAGATATATGGCCAAAAAAACAAGGAGAGGGAAAAGGGGGAAAAGCAATAAATTTTAATTTAATACAAACTAT

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
91.5023168.93931.371252.0410.5431562.89868
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnHuman.ENSG000002352