An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT094486.1

General info


NONCODE TRANSCRIPT IDNONMMUT094486.1
NONCODE Gene IDNONMMUG013195.2
Chromosomechr14
Start Site64096264
End Site64104236
Strand-
Exon Number5
CNCI Score-0.0167936
Length1179
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT094486.1
TGAGACCTCCAGGAGATGGAGGATAGGAAGGGTGTAATGACCTGGGTGACAGTGGAATCCCAACAGACTGGTTTGTAGATGCCCCAGGACACAATGGCTAGAGGCACAGCCTTGATGAATAAGGAAGGAAGCTGAGCCCTATTGAGCCCACCTGGGAGGATGCAACCAGAGGAACGTCTTGGAAATGTCCATCAGAATGACTGCCTCATGAAAGGTTAAACAGTTCACTATGGACGTGAGATTCGTCATAAGGAGAATGAGTAACATGGCCACCCGCTGGAAGCTGAGTTTTGGAATTCATCAGCTCTGCCCTGATTCTTTCTTGCATGAGACCAGTTGGATCACTGCGTGCAGTGCTTCAGAAGTTCAATTCCAGATCTGGAGACTGTGGGATCGGGGTGCAAGGCTGGAGAGGGCCCTGACCTTGTATTTCCAGGAGAGCCTGCCTGATAACTGTCCATCTTCCCGGAGATGAAAGTGCTGGGACAGCTGAGAAAGGTGGACCTAGACTGAGGGTTCAGTAACCCTTCTCTTGGGCCTCTCACAACTATTTGAATCCCTGAGGTGGAATTAGGAAGGTTGACAGCTATGAGGGCAGGGCCGAGCTCAGTTAGGGAGGAGCTGGAATTTCAACACTGAAAACTTGGATGAAGACATTTTGATGTTGGCATGAACATCATGGACATTGTAGCAACTAAACAGACTAGCCAAAGCAATCAGCCATGAGGGTAGAGAGACTCTCTCCTTCCTAGACCCAGGGAAAGCCACAGGGGTGAAGAAGGGGCCATCAGTGGGAACTGGGCCAGTGACAGCACTGTGACCTAAACAGGAAGGGGAGAGGAAATAAATACCCCACTGGCCCTCTGAAGTCTTCCATAAGTGACCAGCCCGGTGCTCTGCAGGAAAGGAGCCAAGCCACCAATACTCAACGCTCCAGGGAAGCCACCGGGTTGGATATCTCAACAAATGGTGGACTATATGTGAGGCAAACAGATGAACAAGCCAAATGATTTTATGGAATCCATAAAAATGACCGTTATTTCCATGTTCTGAGCTTCTTCTAGACCCCATGTGTTTATCTATGTAATTTCATCCATTTCGTCTACTTGACTTAACTGAGGGGCATTGCTGTCGTTCTATGGATGGGAAAAGGTAATAAAAGAAGGTACTCCCCAGACT

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
00000.1346730
Loading...

Isoforms

Transcript ID
NONMMUT021266.2
NONMMUT021267.2
NONMMUT021268.2

Data Sources

Source NameOld Id
PMID24463510ENSMUSG00000091686_dup1