An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT099695.1

General info


NONCODE TRANSCRIPT IDNONMMUT099695.1
NONCODE Gene IDNONMMUG016457.2
Chromosomechr16
Start Site38569323
End Site38573301
Strand-
Exon Number2
CNCI Score-0.0409600
Length549
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT099695.1
AGCTCCAAGGCACCTGAAGACTTACCAGTGAAGTACAAGAAGCAGGATGATTGTACGGATACCACCACACCGTCTTATAGATGTTGATATACTGAATGAACAGAACAATCAGCAGGTAGATGAAGAAAAGAAATTCAAAGAACAGGCTCCCATCTACTGGCTCGGTCTTAGCACCATCTTCCTTGAGACTCCTGCACCATGAGAGCGATGTGGTGGAAGAAGAGAATGTGCAGGCTGAGGTGCAAGAGAAGAAAGATGAGGCAGAGGTCCAGGTAAACCAGCCTGTGCACCCTCGAAGCCTGCAGAAGTTAGGGATGCTCAAGGCCGGGACACCAGAACAAGCTGTCGGACTATATGCTGCTGTTGGTAATAAGTCTCAGGAGACCTGGAACGTCACCTCGCCATGATCACCTGGGAAAATGACTGCCTTTCTTACGGCCAAAACAGTCCTGCTGGACCTCTGCCCTGGACCTTTGGCACTCTGGACTAGTTCTGCTCTCTCTCGTGTACAATAAATCCTCTTGTTCTCAGCTAAAGAATCAAACAAAA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
0.6080791.603490.0002253770.08049740.325940
Loading...

Isoforms

Transcript ID
NONMMUT026571.2

Data Sources

Source NameOld Id
PMID24463510ENSMUSG00000091238