An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT101445.1

General info


NONCODE TRANSCRIPT IDNONMMUT101445.1
NONCODE Gene IDNONMMUG063486.1
Chromosomechr17
Start Site74200970
End Site74294796
Strand+
Exon Number9
CNCI Score-0.0040960
Length1169
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT101445.1
AATATTTTGATTCCAGCCTTCCTTCCACTGCCTCAAACTAGAAAGCATTTTTAAAATGAGTTGAAATTAAGGAGGACTACACCTACTAGAAAAGAAGAAGAGAGTTCTATTAGTCTGAGGTTTCAGAATCCCCCCACACCAGAACCAACATCTTGGTAAAGGCTAGGCTGGACCCTGGACAGAGTACGAGTCTGTGCAGGTGGTGTCCCTGAGGATCGGAGCTTCAGTGGACCGTGAGTGCTCCAGCTGCGTAACTGACTGAACTGTCTTGCCAGCTTCTACACTGGCTCGACTGGGCATAATTCAAAAAGGAAAAGCTCATATTCATTCCATTCTTCTGAAGCTCTGTGATAGCCATTTAATAACACCCCAATGGGATGTCTTCCACATATAGTATTATGATATTTCTTCAAATAATTGCTAAAAGATACAGGATCTAATTGTTCTATAATACTCATACCCTCATTTTATCTAGATGTTCAATGGATCTATAAATCTCCCCCTGGGATTCATCATAGTAACTGTAACGGAACCTTTGACCTCCCCAGTGGCAGAAATCAGAAGAAACCACAAAGAGATTACTAGGATCCGCTAGATATTTACTGAAGAGTTTTCCGAATTCCTGTTCTTTTGACTCACTCAGAGCTCCAACCAGTACAGGAATAATGGTAAACTCATCTTTATGGCTTTTTCCATGGCTTTAGCTGTATAAGGCAAATGCATTTCAATACTGTGTTCATCTTCATCTGTCTGCAGAGACATTCGTTCAAACATTCCTGTCTTCCATAGCTCTCCGTAAACCTTTTGGTCAATACGAAGATCATACAGAGGAGTCCTATATATATCCACACTGGAGAGTGCACATCGAGACAGGGGCACATGATGGGAAGGCCCAAGGATGAAAATTCTCCGGCTAACAGATGGATCCACTTGTTTGTAAGCATGGGCAGCACAGGACCCACAGTATGTGTATCCCGCATGGCCAATAATGGCTCTAGCAGGTCTTTTCGTAGACTGTACTTGTGAAAGCCAACCTTCCAGCTGAGCGTTCAGCTGAGGTCCTACTGAGGCGGTGTACCAGCTCCCGGCGTGGCTGGCTTCCCGGCAGACCACTCGGTTGGACATCTTGGTGCCTGTGCCGCCTATGGTGCACGAGGATGAATGAGGAG

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
10.464410.57423.316286.652745.880691.96864
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnHuman.ENSG000002557