An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT105391.1

General info


NONCODE TRANSCRIPT IDNONMMUT105391.1
NONCODE Gene IDNONMMUG021151.2
Chromosomechr19
Start Site29806487
End Site29826929
Strand+
Exon Number4
CNCI Score-0.0499712
Length3200
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT105391.1
GGGGAGAGAGGCGAAGAAAGAGCTGCCTCCGCCATGCCCGGCGCGCATGCGTAGTAGCACGGGATGGCCCCGCCCCGCTACGCGAAAGCCCTGGACTTGGCTCTCCCACAGGCTCGGAGGCCCAGGGTGTGGCGCGGACTAATGATGTCATCAATATGCGGACGTCTGTAAGGGGTGGGGTGGAGGGAGAAACAGAGCGCCTGCGCTGGCGCAGTCTGGAAGGTGAACCATAGACTGAAAGTTTCCTTTTGGTTAATTATAGATAAGAGAAGAACTGGCACTTAGTCCCACCACCCAGAGAAAACATAAACTTCAAGGTAGCTATTTTTCTATTTATTGGAAGCCACGATAACCAGTGTGGGAGAACTTCATCCACATTTACACAGTTGGGCTTAAACTTCAGAATCTTTCCGATTGCTGAGATACAGTTCTCTGTAGCAATCACATTCTTTTTGGTTTTGGAATTTGCACACTTAATAACTTTTACCAAGAGTGGAACGGCTTCTGAACACAAGGAACGGTAGTCATCTCCACCAAACTGTGCCATGACTCCCAGTCCATAAGCAGCAGCTTGTCTGACTTCAGGGTTGTTGTCTCGCATATTGAGAAGCATCGGCCACCGGAAATACTCAACATACTTGAATGAGGTTGGACTGCAATGCTCTATGATGTCATCAAATATGCATAGTCCCCATTGTCTGTCTGGCCATGGCCTACTTGAACAAATTAGATTTACAATTAGTGGGAGTAGCTGCTCAAACCATGGCAAAATTTTTTCCTTGTAAGTACTAAATAATGAGTGCAAAATATCTGATACTTTGGTCAGAATATAAACATCACATTCATCCTCATCTTGAAGAGACATTTCAACCTGTTGGTCATAATTTTCTTCTTGCCTTTTTACTTGCCGTAACTCTTGGTTTTTAAAGTGCCCTTCAAGTTTTGCCTTCAAAATTCCTCCCAGTTCTTCCAAGTGTTCATCGTTGAGGCAACCATCTCCCATGACCTCAATGGACTTGGCAAAAGAATTCATTATTTCTGAGAGTACATCTGTATCAGGTTCAGTTCCAATTGCCTTGATTAAGGGATCACATATAAACTGCCACATCTGTGAAAGATACTCTGAGCCACGAATTCTTGCACATTCCAAGAGAAAGGGCATGGCTTCCGCAGCTGCCACTCGAACATTGTCATGAAAATAAAATTTCAGCAGAGGAACCATCATCTTCACAACTTGTTCCGTGTATTCCACAAATCCTTCTCTTAACTCCTTCGCATAGTAAACCAACATCTGGCAAGCAGTTGCTTTTGCTTCAAGTCCTGAAGTTTTGATGCCAAAGCTTTGCTGGTCTCCGAGGTTTACAAACTGCCAGCCATCGTCGTCACTCATGTTCTCCACATCCTGTGTGTCTAAGAGAGCGACATCAGGCTTAGCTGAAGCAGTCTTGATAAGTGGCTCAATAACCAGTGGGAGATATTGCTCAAAGTCTTTGCCAAGGATTTTACACATTCTAGCCCAGGCTGAAACCATGTAAGAAGTCTGAGGGTCATCATCTTCCATGTTATTTAAGTCTGATTGTGTTTTCAACAGTAACTGCATCACATTTGATGCATCTTGCATAAATTTTTCCTTCCCAACGGCAAGTCCAACATGGCTAATGCATTCAATAGTTTTTCCTCGAAGAAGCTTGAGTTCCTTTTGAACAGCGAGCTCAACAACGTGTTTGAGTGAGGGCATAAATATATCATAATATGGAATAAAGCTTTCTTCTATTGCATCTGCAACGGAAGCAATGGTTGTCACAAGTTGTTCTAAGGCCAACTTAGTTCCATTCCGAATCAGCTCTTGAAGTTTAATTACCAAGATGGAATGGAGACTTTTTACCATATTTTCCAAATATAGAATTAGCAATGACTTGGGGCAGTCTTCAATAAAAATAACAAGAGCAGAAGCTGCGTGAGATTGCACACGTTGATTACCTTGGTTTTCCATGGTTCGCAACAAAGCTGTAATCACTATCTCATGGAATTTCTTTTGGAAACTAGGTGCAAAATCTGTAGCCATCTGTCCAAGTGTAGTACAGGCAGCAGCCCTTACCCTTGGATGAGGATCCTGAAGAAAAAGTAAAACCGAGTTAACTGTTTCATCTAGAATTGGTTCCATTTGCTGATGGCAACCTTCTCCAATGGCTGATAAGGCCATTAATCCGGCGTGTCGACATTTCCAGTCAGGGCTCTGAAGCATCTGCATGATATGCTCCTTGGTCATTGGCAAAACAACTTTCCCACCAAGTCCACAAGCCAGTCTGTCTAGGGCACTCTCAGCAGCAACCGCATTGCTGTCAAAGTCATCTTCTTCCATTTCATCAGCATTTACCCAGTCATCATCATCTTGAAGATCAACCATCATTGCTAATATATGAGGCACAGCCTGTGCAATAATATTCGTATGCTTTTTCAACATTGGAGTTGCAGTTTCAGATAAGGTGACTATTACTTCCAGAGCCAGCTGGCGTTGCAGGTTACTAAGCCTAGAGTCTCCACACAACTTCAGGCTCAACTGCAGAGTATCTTCTAGATAGGGACCCAAGTACTTAGGTACAGTATCTGCAATCTCAACAAGGGATTCTAGCACAGAATCATCATCCTGGTAGCAGGAATCATTCACAGCCTGTAAGATCCCAGGAAGCAAATCCGCAAAGTCTTTGAAAAGAGCAATATTGTTTTCATTAGCAAGGACGAACGTAGCTGCAGCTCTAGCAGATAATGTCCTGATTGCTGGATGCTCCTGATCTTGAATACACTGGTCCAACAACCTCTTGATGATATCCAAATCGTGACGATCCTGGTTCCCAAAAATCCCAGGAAAGTGCCAGAAAACGTGAAGTGCAACTTCCCACAGAACCACATTTTTAGAGTGAATCGAATCAATGAGGAATTTCAGACCTTCTGGCCAATGGTATCATGAAGGCTCTGCCAAGAGATGGAATTTGGAATAAGGATGATATGACTTACAGGAAGCCAGAGGCTTGAGTGTCACTTCTGGCCACCAAGGACTGTGGTGAAGAAGGAAGCCAGACTGAGGGACAGTTGAGTAGAGAGGGCCTTGCTGCATACCACATTTGGGCTGTAGAAGGAGCTCTCACACCAATCATGGCCAGCCTGTGCATAGTATGGGACATTGCTCACACCTTCTGAGA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
1.727851.731420.000480233.4811805.70445
Loading...

Isoforms

Transcript ID
NONMMUT034397.2

Data Sources

Source NameOld Id
PMID24463510LocusForward_68783